Incidental Mutation 'R6005:Pcdhb22'
ID479453
Institutional Source Beutler Lab
Gene Symbol Pcdhb22
Ensembl Gene ENSMUSG00000073591
Gene Nameprotocadherin beta 22
SynonymsPcdhbV, Pcdhb15
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6005 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37517871-37524479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37519736 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 162 (I162N)
Ref Sequence ENSEMBL: ENSMUSP00000095214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061405] [ENSMUST00000097609] [ENSMUST00000115661] [ENSMUST00000192409] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000061405
SMART Domains Protein: ENSMUSP00000056424
Gene: ENSMUSG00000044022

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Cadherin_2 30 110 4.2e-30 PFAM
CA 153 238 1.8e-17 SMART
CA 262 343 1.54e-25 SMART
CA 367 448 1.03e-21 SMART
CA 472 558 3.41e-27 SMART
CA 588 669 1.54e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097609
AA Change: I162N

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095214
Gene: ENSMUSG00000073591
AA Change: I162N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 28 110 5.8e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
Pfam:Cadherin_C_2 685 768 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192409
AA Change: I419N

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141521
Gene: ENSMUSG00000073591
AA Change: I419N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 27 110 2.5e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
transmembrane domain 689 711 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.8215 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
4930412O13Rik T C 2: 9,882,827 probably benign Het
7530416G11Rik A T 15: 85,494,109 I111N unknown Het
Adgb C T 10: 10,395,352 R849H probably damaging Het
Ahnak T C 19: 9,015,161 V4603A possibly damaging Het
AI464131 T A 4: 41,498,895 H245L probably benign Het
Ank1 A G 8: 23,132,202 D1589G probably damaging Het
Ankrd2 A G 19: 42,040,115 D70G probably damaging Het
Arid2 T C 15: 96,370,972 S989P probably benign Het
Bbs1 A T 19: 4,903,795 Y113* probably null Het
Bfsp2 T G 9: 103,448,550 K298T probably damaging Het
Bpi G A 2: 158,262,480 V168I possibly damaging Het
Cacna2d1 T C 5: 16,361,821 S921P probably damaging Het
Clec4d A C 6: 123,267,159 T76P probably damaging Het
Coq8b C T 7: 27,257,325 Q468* probably null Het
Dennd6b T C 15: 89,188,168 E248G possibly damaging Het
Ednra A G 8: 77,674,927 S245P possibly damaging Het
Epb41l4a C T 18: 33,828,143 C446Y probably benign Het
Fam221a A G 6: 49,367,822 probably benign Het
Fam229a T C 4: 129,491,503 S76P probably benign Het
Fryl C T 5: 73,083,295 D1321N probably damaging Het
Gli2 C T 1: 118,842,064 R586H probably damaging Het
Gm13089 T A 4: 143,698,432 H147L probably benign Het
Gm94 C T 18: 43,792,797 A16T possibly damaging Het
Gorasp2 T C 2: 70,690,751 V355A probably benign Het
Grid1 C A 14: 35,323,412 T404N probably damaging Het
Gtf2i C A 5: 134,255,958 E475* probably null Het
Gucy1a2 T C 9: 3,865,518 probably null Het
Hs3st5 T A 10: 36,832,928 I153N probably damaging Het
Il11ra1 T C 4: 41,763,887 probably null Het
Ireb2 G A 9: 54,908,805 G887S probably damaging Het
Kdsr T C 1: 106,734,581 E248G probably benign Het
Lemd2 C G 17: 27,190,785 R464P probably damaging Het
Lrrfip1 T C 1: 91,114,611 V246A probably damaging Het
Macf1 T A 4: 123,474,275 D2231V possibly damaging Het
Map2k5 C T 9: 63,281,019 D283N probably damaging Het
Mfsd5 A G 15: 102,281,492 D433G possibly damaging Het
Mir700 C A 4: 135,412,307 probably null Het
Mroh9 A T 1: 163,075,677 F52L probably damaging Het
Mycbp2 A C 14: 103,156,723 S2691A probably benign Het
Nktr T A 9: 121,748,394 probably benign Het
Obsl1 C A 1: 75,492,215 probably null Het
Olfr1130 A T 2: 87,608,080 I231F probably damaging Het
Olfr251 T C 9: 38,378,309 S137P probably damaging Het
Olfr259 A G 2: 87,108,063 V108A probably benign Het
Olfr582 A T 7: 103,041,646 I51F probably damaging Het
Olfr855 C T 9: 19,584,885 T116I probably benign Het
Pde1c A T 6: 56,479,202 probably null Het
Pds5b A G 5: 150,769,776 probably null Het
Pkd1l1 A C 11: 8,857,113 W1568G probably damaging Het
Polr3c A T 3: 96,719,468 M258K possibly damaging Het
Prss12 A T 3: 123,482,768 I349F probably benign Het
Ptpn21 A G 12: 98,678,552 *1177Q probably null Het
Rgs22 T A 15: 36,010,567 K1125M probably benign Het
Rnf182 A G 13: 43,668,035 K21E probably damaging Het
Rpl6 G A 5: 121,205,514 probably benign Het
Samsn1 C T 16: 75,873,514 V234I probably benign Het
Scrib A G 15: 76,057,751 I1089T probably damaging Het
Sec31a T C 5: 100,363,878 T1092A probably damaging Het
Sh3bp2 G T 5: 34,562,465 R606L possibly damaging Het
Sipa1 A G 19: 5,656,201 V367A probably damaging Het
Slc25a44 C T 3: 88,412,846 E269K probably damaging Het
Slc44a4 T A 17: 34,923,454 M353K possibly damaging Het
Sorcs2 A G 5: 36,019,384 S1142P probably damaging Het
Sptbn4 A G 7: 27,418,599 F352L probably damaging Het
Synj1 A T 16: 90,969,286 N541K probably damaging Het
Tas2r113 G A 6: 132,893,696 R229K probably benign Het
Tcaf3 A T 6: 42,589,971 I728K probably benign Het
Tcea1 A G 1: 4,890,773 E167G probably benign Het
Timeless G A 10: 128,244,200 R406H probably damaging Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Traj31 C T 14: 54,187,931 probably benign Het
Ttn A T 2: 76,769,563 V19089D probably damaging Het
Unc80 C T 1: 66,627,257 S1868L possibly damaging Het
Wdr38 A T 2: 39,001,321 I287F possibly damaging Het
Wnt2 G A 6: 18,030,323 probably benign Het
Wnt5b G A 6: 119,433,654 P288L probably benign Het
Xkr5 G T 8: 18,934,505 N174K probably benign Het
Zbtb6 C T 2: 37,428,965 R317Q probably damaging Het
Zcchc7 AGGGG AGGG 4: 44,931,218 probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Pcdhb22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pcdhb22 APN 18 37520132 missense probably damaging 1.00
IGL00775:Pcdhb22 APN 18 37519742 missense probably benign 0.09
IGL01414:Pcdhb22 APN 18 37519496 missense probably damaging 1.00
IGL01819:Pcdhb22 APN 18 37519921 missense probably damaging 1.00
IGL02232:Pcdhb22 APN 18 37520549 missense probably damaging 1.00
IGL03226:Pcdhb22 APN 18 37518956 missense probably damaging 1.00
R0071:Pcdhb22 UTSW 18 37520078 missense probably damaging 1.00
R0363:Pcdhb22 UTSW 18 37519160 missense probably benign 0.01
R0454:Pcdhb22 UTSW 18 37518872 missense probably damaging 0.99
R0624:Pcdhb22 UTSW 18 37518727 missense probably benign 0.00
R0707:Pcdhb22 UTSW 18 37518851 missense probably damaging 1.00
R0918:Pcdhb22 UTSW 18 37520014 missense probably damaging 1.00
R1112:Pcdhb22 UTSW 18 37519768 missense possibly damaging 0.61
R1299:Pcdhb22 UTSW 18 37520590 missense probably damaging 0.99
R1351:Pcdhb22 UTSW 18 37518574 missense probably benign 0.10
R1488:Pcdhb22 UTSW 18 37519888 missense possibly damaging 0.79
R1595:Pcdhb22 UTSW 18 37520453 missense probably damaging 1.00
R1709:Pcdhb22 UTSW 18 37518500 missense probably benign 0.31
R1725:Pcdhb22 UTSW 18 37520188 missense probably benign 0.04
R1869:Pcdhb22 UTSW 18 37519147 missense probably damaging 1.00
R1871:Pcdhb22 UTSW 18 37519147 missense probably damaging 1.00
R1891:Pcdhb22 UTSW 18 37519304 missense probably damaging 0.97
R4523:Pcdhb22 UTSW 18 37520421 missense probably benign 0.05
R4825:Pcdhb22 UTSW 18 37520660 missense possibly damaging 0.80
R4831:Pcdhb22 UTSW 18 37520562 missense probably damaging 1.00
R4851:Pcdhb22 UTSW 18 37519034 missense possibly damaging 0.89
R4978:Pcdhb22 UTSW 18 37518601 missense probably benign 0.16
R5047:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5061:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5063:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5467:Pcdhb22 UTSW 18 37520135 missense probably benign 0.02
R6375:Pcdhb22 UTSW 18 37518304 intron probably benign
R6418:Pcdhb22 UTSW 18 37519906 missense possibly damaging 0.88
R6447:Pcdhb22 UTSW 18 37520216 missense possibly damaging 0.91
R6748:Pcdhb22 UTSW 18 37518746 missense probably damaging 0.99
R7195:Pcdhb22 UTSW 18 37519288 missense probably damaging 1.00
R7243:Pcdhb22 UTSW 18 37520632 missense probably benign 0.00
R7354:Pcdhb22 UTSW 18 37520258 missense probably damaging 1.00
R7503:Pcdhb22 UTSW 18 37519102 missense probably benign 0.39
R7765:Pcdhb22 UTSW 18 37519105 missense probably damaging 0.99
X0027:Pcdhb22 UTSW 18 37520851 missense probably benign
Z1088:Pcdhb22 UTSW 18 37519345 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- ATTCAGGTGGTGGATGTCAAC -3'
(R):5'- AGCCTGAGTCTGAGTCTGTG -3'

Sequencing Primer
(F):5'- GTGGTGGATGTCAACGATAATTACCC -3'
(R):5'- CTGAGTCTGTGGCGCTGATG -3'
Posted On2017-06-26