Incidental Mutation 'R6006:Mtx1'
ID479465
Institutional Source Beutler Lab
Gene Symbol Mtx1
Ensembl Gene ENSMUSG00000064068
Gene Namemetaxin 1
SynonymsGcap6
MMRRC Submission 044183-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R6006 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89209081-89227088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89210306 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 60 (G60D)
Ref Sequence ENSEMBL: ENSMUSP00000133291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029682] [ENSMUST00000073572] [ENSMUST00000077367] [ENSMUST00000118964] [ENSMUST00000119084] [ENSMUST00000142051] [ENSMUST00000152789] [ENSMUST00000167998] [ENSMUST00000174126] [ENSMUST00000197738]
Predicted Effect probably benign
Transcript: ENSMUST00000029682
SMART Domains Protein: ENSMUSP00000029682
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 2.5e-22 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
EGF 417 456 1.99e0 SMART
Pfam:TSP_3 492 527 1e-12 PFAM
Pfam:TSP_3 551 586 2.2e-16 PFAM
Pfam:TSP_3 586 609 6.6e-7 PFAM
Pfam:TSP_3 610 647 2.6e-14 PFAM
Pfam:TSP_3 648 687 2.4e-10 PFAM
Pfam:TSP_3 688 723 4.2e-15 PFAM
Pfam:TSP_C 741 938 3.3e-99 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000073572
AA Change: G300D

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073261
Gene: ENSMUSG00000064068
AA Change: G300D

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 4.2e-21 PFAM
Pfam:Tom37_C 239 317 8.1e-24 PFAM
Pfam:GST_C_3 267 383 1.7e-11 PFAM
Pfam:GST_C_2 270 377 2.7e-8 PFAM
Pfam:Tom37_C 300 369 1.1e-14 PFAM
low complexity region 396 415 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077367
SMART Domains Protein: ENSMUSP00000076589
Gene: ENSMUSG00000028048

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 512 1.4e-252 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118964
AA Change: G269D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114009
Gene: ENSMUSG00000064068
AA Change: G269D

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 5.9e-21 PFAM
Pfam:Tom37_C 216 287 6.3e-19 PFAM
Pfam:GST_C_3 216 352 5.1e-11 PFAM
Pfam:GST_C_2 238 344 1.9e-8 PFAM
Pfam:Tom37_C 269 338 9.5e-15 PFAM
low complexity region 365 384 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119084
SMART Domains Protein: ENSMUSP00000112912
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 8.2e-26 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
Pfam:TSP_3 455 490 4.4e-13 PFAM
Pfam:TSP_3 514 549 9.3e-17 PFAM
Pfam:TSP_3 549 572 2.8e-7 PFAM
Pfam:TSP_3 573 610 1.1e-14 PFAM
Pfam:TSP_3 611 650 1e-10 PFAM
Pfam:TSP_3 651 686 1.8e-15 PFAM
Pfam:TSP_C 704 904 7.9e-108 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000119222
AA Change: G198D
SMART Domains Protein: ENSMUSP00000113986
Gene: ENSMUSG00000064068
AA Change: G198D

DomainStartEndE-ValueType
Pfam:Tom37 12 57 1.6e-11 PFAM
Pfam:Tom37_C 138 216 5.4e-24 PFAM
Pfam:GST_C_3 166 282 1.1e-11 PFAM
Pfam:GST_C_2 169 276 1.8e-8 PFAM
Pfam:Tom37_C 199 268 7.2e-15 PFAM
low complexity region 295 314 N/A INTRINSIC
transmembrane domain 315 337 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126315
Predicted Effect probably benign
Transcript: ENSMUST00000129055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138633
Predicted Effect probably benign
Transcript: ENSMUST00000142051
SMART Domains Protein: ENSMUSP00000116136
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
TSPN 1 124 2.52e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150303
Predicted Effect probably benign
Transcript: ENSMUST00000152789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156847
Predicted Effect probably benign
Transcript: ENSMUST00000167998
SMART Domains Protein: ENSMUSP00000130660
Gene: ENSMUSG00000028048

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 512 1.4e-252 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173239
Predicted Effect probably benign
Transcript: ENSMUST00000173465
Predicted Effect unknown
Transcript: ENSMUST00000173475
AA Change: G10D
SMART Domains Protein: ENSMUSP00000134110
Gene: ENSMUSG00000064068
AA Change: G10D

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
low complexity region 97 116 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173477
AA Change: G137D
SMART Domains Protein: ENSMUSP00000133282
Gene: ENSMUSG00000064068
AA Change: G137D

DomainStartEndE-ValueType
Pfam:Tom37 1 58 8.5e-16 PFAM
Pfam:Tom37_C 77 155 9.7e-24 PFAM
Pfam:GST_C_3 104 221 8.2e-12 PFAM
Pfam:GST_C_2 107 216 7.5e-9 PFAM
Pfam:Tom37_C 138 207 1.3e-14 PFAM
low complexity region 234 253 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173593
AA Change: G162D
SMART Domains Protein: ENSMUSP00000133866
Gene: ENSMUSG00000064068
AA Change: G162D

DomainStartEndE-ValueType
Pfam:Tom37 14 82 1.1e-21 PFAM
Pfam:Tom37_C 102 178 3.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174126
AA Change: G60D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133291
Gene: ENSMUSG00000064068
AA Change: G60D

DomainStartEndE-ValueType
Pfam:Tom37_C 1 74 7.6e-23 PFAM
Pfam:GST_C_3 7 143 7.3e-12 PFAM
Pfam:GST_C_2 26 137 2.8e-9 PFAM
Pfam:Tom37_C 61 129 6.2e-15 PFAM
low complexity region 159 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196887
Predicted Effect probably benign
Transcript: ENSMUST00000197738
SMART Domains Protein: ENSMUSP00000142401
Gene: ENSMUSG00000028048

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 388 1e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200124
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Mtx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:Mtx1 APN 3 89209317 missense probably damaging 0.99
IGL02544:Mtx1 APN 3 89210396 missense probably damaging 1.00
R1677:Mtx1 UTSW 3 89209341 missense probably benign 0.24
R4944:Mtx1 UTSW 3 89213898 missense probably benign
R7684:Mtx1 UTSW 3 89210432 missense possibly damaging 0.93
R7690:Mtx1 UTSW 3 89212781 missense
R7820:Mtx1 UTSW 3 89214008 missense probably benign 0.09
Z1177:Mtx1 UTSW 3 89213859 missense probably damaging 1.00
Z1177:Mtx1 UTSW 3 89214105 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACTTCTGAGAGCCCAGACG -3'
(R):5'- AGCCATGAGACTTAGAAGCCC -3'

Sequencing Primer
(F):5'- TGAGAGCCCAGACGCTGAG -3'
(R):5'- TTAGAAGCCCACCCCGTG -3'
Posted On2017-06-26