Incidental Mutation 'R6006:Rgs3'
ID479469
Institutional Source Beutler Lab
Gene Symbol Rgs3
Ensembl Gene ENSMUSG00000059810
Gene Nameregulator of G-protein signaling 3
SynonymsC2pa, PDZ-RGS3, RGS3S, C2PA-RGS3, 4930506N09Rik
MMRRC Submission 044183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6006 (G1)
Quality Score204.009
Status Not validated
Chromosome4
Chromosomal Location62559847-62704001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62623906 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 39 (R39Q)
Ref Sequence ENSEMBL: ENSMUSP00000103047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065870] [ENSMUST00000084521] [ENSMUST00000098031] [ENSMUST00000107424]
Predicted Effect probably damaging
Transcript: ENSMUST00000065870
AA Change: R216Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065447
Gene: ENSMUSG00000059810
AA Change: R216Q

DomainStartEndE-ValueType
C2 47 150 7.98e-15 SMART
PDZ 203 272 8.09e-10 SMART
low complexity region 465 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084521
AA Change: R39Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081569
Gene: ENSMUSG00000059810
AA Change: R39Q

DomainStartEndE-ValueType
PDZ 26 95 8.09e-10 SMART
low complexity region 288 298 N/A INTRINSIC
internal_repeat_1 407 447 2.05e-9 PROSPERO
internal_repeat_1 456 501 2.05e-9 PROSPERO
low complexity region 645 674 N/A INTRINSIC
RGS 841 957 3.66e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098031
AA Change: R208Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095639
Gene: ENSMUSG00000059810
AA Change: R208Q

DomainStartEndE-ValueType
C2 39 142 7.98e-15 SMART
PDZ 195 264 8.09e-10 SMART
low complexity region 457 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107424
AA Change: R39Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103047
Gene: ENSMUSG00000059810
AA Change: R39Q

DomainStartEndE-ValueType
PDZ 26 95 8.09e-10 SMART
low complexity region 288 298 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154071
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signaling (RGS) family. This protein is a GTPase-activating protein that inhibits G-protein-mediated signal transduction. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. Long isoforms are largely cytosolic and plasma membrane-associated with a function in Wnt signaling and in the epithelial mesenchymal transition, while shorter N-terminally-truncated isoforms can be nuclear. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired T cell migration in model of Th2-mediated airway inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Rgs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Rgs3 APN 4 62701180 missense possibly damaging 0.87
IGL00918:Rgs3 APN 4 62701067 missense probably damaging 1.00
IGL01594:Rgs3 APN 4 62619744 missense probably damaging 0.99
IGL01761:Rgs3 APN 4 62652709 splice site probably benign
IGL02995:Rgs3 APN 4 62625847 missense possibly damaging 0.95
IGL03365:Rgs3 APN 4 62689675 missense probably benign
R0098:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0098:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0158:Rgs3 UTSW 4 62623884 missense probably damaging 1.00
R0609:Rgs3 UTSW 4 62625936 missense probably damaging 1.00
R0633:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0637:Rgs3 UTSW 4 62646673 splice site probably benign
R0893:Rgs3 UTSW 4 62605561 splice site probably null
R1612:Rgs3 UTSW 4 62625935 missense probably damaging 0.99
R1929:Rgs3 UTSW 4 62702147 missense probably damaging 1.00
R2202:Rgs3 UTSW 4 62690504 missense probably damaging 1.00
R2239:Rgs3 UTSW 4 62625887 missense probably benign 0.30
R2380:Rgs3 UTSW 4 62625887 missense probably benign 0.30
R2974:Rgs3 UTSW 4 62640720 missense probably damaging 1.00
R4871:Rgs3 UTSW 4 62631295 missense probably benign 0.01
R5229:Rgs3 UTSW 4 62702187 missense probably damaging 1.00
R5372:Rgs3 UTSW 4 62652697 intron probably benign
R5597:Rgs3 UTSW 4 62623845 missense probably damaging 1.00
R6056:Rgs3 UTSW 4 62625906 missense probably damaging 0.96
R6732:Rgs3 UTSW 4 62602943 missense probably benign 0.00
R6962:Rgs3 UTSW 4 62700715 intron probably benign
R7141:Rgs3 UTSW 4 62690487 missense probably damaging 1.00
R7156:Rgs3 UTSW 4 62617126 missense probably damaging 0.99
R7193:Rgs3 UTSW 4 62615336 missense probably damaging 0.99
R7459:Rgs3 UTSW 4 62625154 missense probably benign 0.01
R7660:Rgs3 UTSW 4 62701112 missense possibly damaging 0.94
R7697:Rgs3 UTSW 4 62657142 missense probably benign 0.00
R8025:Rgs3 UTSW 4 62690594 missense probably damaging 0.97
Z1177:Rgs3 UTSW 4 62631214 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TTGGGGCTGTTAGGACCAAG -3'
(R):5'- AGCTCCTCTTCAGAAACGAGC -3'

Sequencing Primer
(F):5'- CTTTGCATAAGTCAGGGTTAAGATG -3'
(R):5'- TCCTCTTCAGAAACGAGCAGAATC -3'
Posted On2017-06-26