Mutagenetix > Incidental Mutation

Incidental Mutation 'R6006:Glis1'

479470

Institutional Source

Beutler Lab

Gene Symbol

Glis1

Ensembl Gene

ENSMUSG00000034762

Gene Name

GLIS family zinc finger 1

Synonyms

GliH1

MMRRC Submission

044183-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6006 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107434591-107635061 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107567906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 238 (L238P)

Ref Sequence

ENSEMBL: ENSMUSP00000035650 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046005] [ENSMUST00000106738] [ENSMUST00000135835]

AlphaFold

Q8K1M4

Predicted Effect

probably damaging
Transcript: ENSMUST00000046005
AA Change: L238P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035650
Gene: ENSMUSG00000034762
AA Change: L238P

Domain	Start	End	E-Value	Type
low complexity region	50	62	N/A	INTRINSIC
low complexity region	118	129	N/A	INTRINSIC
low complexity region	242	255	N/A	INTRINSIC
low complexity region	274	288	N/A	INTRINSIC
low complexity region	334	357	N/A	INTRINSIC
ZnF_C2H2	366	391	3.99e0	SMART
ZnF_C2H2	400	427	4.12e0	SMART
ZnF_C2H2	433	457	7.78e-3	SMART
ZnF_C2H2	463	487	1.45e-2	SMART
ZnF_C2H2	493	517	5.59e-4	SMART
low complexity region	543	557	N/A	INTRINSIC
low complexity region	635	658	N/A	INTRINSIC
low complexity region	666	686	N/A	INTRINSIC
low complexity region	721	735	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106738
AA Change: L50P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102349
Gene: ENSMUSG00000034762
AA Change: L50P

Domain	Start	End	E-Value	Type
low complexity region	54	67	N/A	INTRINSIC
low complexity region	86	100	N/A	INTRINSIC
low complexity region	146	169	N/A	INTRINSIC
ZnF_C2H2	178	203	3.99e0	SMART
ZnF_C2H2	212	239	4.12e0	SMART
ZnF_C2H2	245	269	7.78e-3	SMART
ZnF_C2H2	275	299	1.45e-2	SMART
ZnF_C2H2	305	329	5.59e-4	SMART
low complexity region	355	369	N/A	INTRINSIC
low complexity region	447	470	N/A	INTRINSIC
low complexity region	478	498	N/A	INTRINSIC
low complexity region	533	547	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135835

SMART Domains

Protein: ENSMUSP00000118600
Gene: ENSMUSG00000034762

Domain	Start	End	E-Value	Type
low complexity region	50	62	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.3%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GLIS1 is a GLI (MIM 165220)-related Kruppel-like zinc finger protein that functions as an activator and repressor of transcription (Kim et al., 2002 [PubMed 12042312]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mice do not exhibit any overt abnormalities, including behavior, kidney or tooth morphology, up to 6 months of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	A	G	8: 123,968,065	I296T	probably benign	Het
Abcb4	C	A	5: 8,946,026	T894K	probably damaging	Het
Acad12	C	T	5: 121,599,236	V491I	possibly damaging	Het
Actr8	T	A	14: 29,984,142		probably null	Het
Adam7	A	C	14: 68,511,396	D467E	probably damaging	Het
Adamts18	A	T	8: 113,706,974	C1043S	probably damaging	Het
Adgrb3	T	G	1: 25,826,531	D77A	possibly damaging	Het
Arhgap20	T	A	9: 51,850,126	D1056E	probably benign	Het
Bco1	A	G	8: 117,113,591		probably null	Het
Btn2a2	A	T	13: 23,486,363	W67R	probably damaging	Het
Camkmt	A	T	17: 85,452,238	N269Y	possibly damaging	Het
Cand1	A	G	10: 119,210,028	F991L	possibly damaging	Het
Cchcr1	A	G	17: 35,524,700	K234E	possibly damaging	Het
Cd14	T	C	18: 36,726,282	D40G	possibly damaging	Het
Cdc73	A	T	1: 143,617,439	F386I	probably damaging	Het
Cdk14	C	T	5: 5,249,211	M1I	probably null	Het
Cnpy3	A	C	17: 46,736,864	S220A	probably benign	Het
Col22a1	A	G	15: 71,973,836	V359A	probably damaging	Het
Col6a3	C	A	1: 90,768,383	C2654F	unknown	Het
Colgalt2	A	G	1: 152,473,161	T186A	probably damaging	Het
Cpsf4l	A	G	11: 113,699,927	V199A	probably benign	Het
Dhtkd1	G	A	2: 5,904,025	Q753*	probably null	Het
Ep400	A	G	5: 110,704,959	S1307P	unknown	Het
Fer1l6	T	C	15: 58,647,044	V1675A	probably damaging	Het
Gm35339	T	C	15: 76,357,172	V626A	probably damaging	Het
Iqgap3	T	A	3: 88,091,547	D318E	probably damaging	Het
Lats1	T	C	10: 7,705,595	F715L	probably damaging	Het
Mlxip	T	C	5: 123,445,658	F428S	possibly damaging	Het
Morc3	T	G	16: 93,866,493	I528R	possibly damaging	Het
Mtx1	C	T	3: 89,210,306	G60D	probably damaging	Het
Mug2	G	C	6: 122,083,500	Q1398H	probably null	Het
Mup8	T	C	4: 60,220,403	I110V	probably benign	Het
Nfkb1	A	T	3: 135,603,761	L12*	probably null	Het
Numa1	G	A	7: 101,992,719		probably null	Het
Olfr670	T	G	7: 104,960,663	E23A	probably damaging	Het
Pbk	C	T	14: 65,816,645	P213L	probably damaging	Het
Pdcd1lg2	T	A	19: 29,454,505	H224Q	possibly damaging	Het
Pkp1	C	G	1: 135,877,668		probably null	Het
Rela	A	G	19: 5,639,939	N139S	probably damaging	Het
Rgs3	G	A	4: 62,623,906	R39Q	probably damaging	Het
S1pr3	A	G	13: 51,419,695	E304G	probably damaging	Het
Sertad2	G	A	11: 20,647,884	G27S	probably benign	Het
Setmar	T	C	6: 108,076,426	S294P	possibly damaging	Het
Smc2	A	G	4: 52,459,024	N473S	probably benign	Het
Ssr1	TCTCTTTC	T	13: 37,985,996		probably null	Het
Tigd2	A	G	6: 59,210,777	I210V	possibly damaging	Het
Tmprss9	T	A	10: 80,883,721	F93L	possibly damaging	Het
Ttc30a1	A	G	2: 75,981,488	Y84H	probably benign	Het
U2surp	T	C	9: 95,479,307	Y633C	probably damaging	Het
Usp18	A	T	6: 121,262,822	E292V	possibly damaging	Het
Usp32	A	C	11: 84,992,451		probably null	Het
Utp18	T	C	11: 93,885,623	D12G	probably benign	Het
Vmn1r216	C	A	13: 23,099,758	H204N	probably benign	Het
Wwc1	A	T	11: 35,870,982	V619E	probably null	Het
Wwc1	T	C	11: 35,889,273	D285G	probably damaging	Het
Zfp3	A	T	11: 70,771,764	Q183L	probably benign	Het
Zfp955a	A	G	17: 33,241,686	C491R	probably damaging	Het

Other mutations in Glis1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02157:Glis1	APN	4	107627561	missense	probably benign	0.01
IGL02450:Glis1	APN	4	107627529	missense	probably benign	0.25
IGL03167:Glis1	APN	4	107435905	missense	possibly damaging	0.90
IGL03189:Glis1	APN	4	107615051	missense	probably damaging	1.00
IGL03377:Glis1	APN	4	107632281	missense	probably damaging	0.98
glenys	UTSW	4	107627543	missense	possibly damaging	0.91
R0551:Glis1	UTSW	4	107568119	splice site	probably null
R0981:Glis1	UTSW	4	107615042	missense	probably damaging	1.00
R1036:Glis1	UTSW	4	107632264	missense	probably benign	0.05
R1527:Glis1	UTSW	4	107567926	missense	probably damaging	0.96
R1741:Glis1	UTSW	4	107568347	missense	probably damaging	1.00
R2937:Glis1	UTSW	4	107632291	missense	possibly damaging	0.89
R2938:Glis1	UTSW	4	107632291	missense	possibly damaging	0.89
R4223:Glis1	UTSW	4	107567845	missense	probably benign	0.01
R4412:Glis1	UTSW	4	107634718	missense	probably damaging	0.99
R4587:Glis1	UTSW	4	107627543	missense	possibly damaging	0.91
R4685:Glis1	UTSW	4	107567645	missense	probably benign	0.00
R4900:Glis1	UTSW	4	107619564	missense	probably damaging	1.00
R5138:Glis1	UTSW	4	107623105	frame shift	probably null
R5167:Glis1	UTSW	4	107634694	missense	probably damaging	1.00
R5511:Glis1	UTSW	4	107435877	missense	probably damaging	0.99
R5568:Glis1	UTSW	4	107619635	missense	probably damaging	0.99
R5807:Glis1	UTSW	4	107568082	missense	probably benign	0.00
R6180:Glis1	UTSW	4	107627513	missense	probably benign	0.06
R6219:Glis1	UTSW	4	107631905	missense	probably benign	0.27
R6856:Glis1	UTSW	4	107435879	missense	probably damaging	0.96
R7278:Glis1	UTSW	4	107435683	start codon destroyed	probably null	0.53
R7877:Glis1	UTSW	4	107634703	missense	probably damaging	1.00
R7937:Glis1	UTSW	4	107627526	missense	possibly damaging	0.68
R7940:Glis1	UTSW	4	107632374	missense	probably damaging	1.00
R7940:Glis1	UTSW	4	107632375	missense	probably damaging	0.99
R7954:Glis1	UTSW	4	107619657	missense	possibly damaging	0.82
R8078:Glis1	UTSW	4	107567902	missense	probably damaging	1.00
R8931:Glis1	UTSW	4	107563863	missense	probably benign	0.35
R9227:Glis1	UTSW	4	107568130	missense	probably benign	0.45
R9230:Glis1	UTSW	4	107568130	missense	probably benign	0.45
R9767:Glis1	UTSW	4	107634597	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CCTCAGGCTACGTTTGTGAAC -3'
(R):5'- GCATGCTTCAAGCTGCAAG -3'

Sequencing Primer
(F):5'- TTTGTGAACGGCAGCCTC -3'
(R):5'- TCCTGGCCGTCACTGGATG -3'

Posted On

2017-06-26