Incidental Mutation 'R6006:Abcb4'
ID 479472
Institutional Source Beutler Lab
Gene Symbol Abcb4
Ensembl Gene ENSMUSG00000042476
Gene Name ATP-binding cassette, sub-family B member 4
Synonyms mdr-2, Mdr2, Pgy2, Pgy-2
MMRRC Submission 044183-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 8943717-9009231 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 8996026 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 894 (T894K)
Ref Sequence ENSEMBL: ENSMUSP00000003717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003717] [ENSMUST00000196067]
AlphaFold P21440
Predicted Effect probably damaging
Transcript: ENSMUST00000003717
AA Change: T894K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003717
Gene: ENSMUSG00000042476
AA Change: T894K

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 342 2e-94 PFAM
AAA 418 610 3.97e-20 SMART
Pfam:ABC_membrane 708 982 6.3e-77 PFAM
AAA 1058 1246 4.49e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196067
SMART Domains Protein: ENSMUSP00000142425
Gene: ENSMUSG00000042476

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 344 2.4e-95 PFAM
AAA 418 610 6.2e-22 SMART
Pfam:ABC_membrane 708 882 1.6e-37 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are unable to secrete phospholipids into bile, leading to progressive hepatic disease, with an end stage of 3 months. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 124,694,804 (GRCm39) I296T probably benign Het
Acad12 C T 5: 121,737,299 (GRCm39) V491I possibly damaging Het
Actr8 T A 14: 29,706,099 (GRCm39) probably null Het
Adam7 A C 14: 68,748,845 (GRCm39) D467E probably damaging Het
Adamts18 A T 8: 114,433,606 (GRCm39) C1043S probably damaging Het
Adgrb3 T G 1: 25,865,612 (GRCm39) D77A possibly damaging Het
Arhgap20 T A 9: 51,761,426 (GRCm39) D1056E probably benign Het
Bco1 A G 8: 117,840,330 (GRCm39) probably null Het
Btn2a2 A T 13: 23,670,533 (GRCm39) W67R probably damaging Het
Camkmt A T 17: 85,759,666 (GRCm39) N269Y possibly damaging Het
Cand1 A G 10: 119,045,933 (GRCm39) F991L possibly damaging Het
Cchcr1 A G 17: 35,835,597 (GRCm39) K234E possibly damaging Het
Cd14 T C 18: 36,859,335 (GRCm39) D40G possibly damaging Het
Cdc73 A T 1: 143,493,177 (GRCm39) F386I probably damaging Het
Cdk14 C T 5: 5,299,211 (GRCm39) M1I probably null Het
Cnpy3 A C 17: 47,047,790 (GRCm39) S220A probably benign Het
Col22a1 A G 15: 71,845,685 (GRCm39) V359A probably damaging Het
Col6a3 C A 1: 90,696,105 (GRCm39) C2654F unknown Het
Colgalt2 A G 1: 152,348,912 (GRCm39) T186A probably damaging Het
Cpsf4l A G 11: 113,590,753 (GRCm39) V199A probably benign Het
Dhtkd1 G A 2: 5,908,836 (GRCm39) Q753* probably null Het
Ep400 A G 5: 110,852,825 (GRCm39) S1307P unknown Het
Fer1l6 T C 15: 58,518,893 (GRCm39) V1675A probably damaging Het
Glis1 T C 4: 107,425,103 (GRCm39) L238P probably damaging Het
Ift70a1 A G 2: 75,811,832 (GRCm39) Y84H probably benign Het
Iqgap3 T A 3: 87,998,854 (GRCm39) D318E probably damaging Het
Lats1 T C 10: 7,581,359 (GRCm39) F715L probably damaging Het
Mlxip T C 5: 123,583,721 (GRCm39) F428S possibly damaging Het
Morc3 T G 16: 93,663,381 (GRCm39) I528R possibly damaging Het
Mtx1 C T 3: 89,117,613 (GRCm39) G60D probably damaging Het
Mug2 G C 6: 122,060,459 (GRCm39) Q1398H probably null Het
Mup8 T C 4: 60,220,403 (GRCm39) I110V probably benign Het
Nfkb1 A T 3: 135,309,522 (GRCm39) L12* probably null Het
Numa1 G A 7: 101,641,926 (GRCm39) probably null Het
Or52e18 T G 7: 104,609,870 (GRCm39) E23A probably damaging Het
Pbk C T 14: 66,054,094 (GRCm39) P213L probably damaging Het
Pdcd1lg2 T A 19: 29,431,905 (GRCm39) H224Q possibly damaging Het
Pkp1 C G 1: 135,805,406 (GRCm39) probably null Het
Rela A G 19: 5,689,967 (GRCm39) N139S probably damaging Het
Rgs3 G A 4: 62,542,143 (GRCm39) R39Q probably damaging Het
S1pr3 A G 13: 51,573,731 (GRCm39) E304G probably damaging Het
Sertad2 G A 11: 20,597,884 (GRCm39) G27S probably benign Het
Setmar T C 6: 108,053,387 (GRCm39) S294P possibly damaging Het
Smc2 A G 4: 52,459,024 (GRCm39) N473S probably benign Het
Ssr1 TCTCTTTC T 13: 38,169,972 (GRCm39) probably null Het
Tigd2 A G 6: 59,187,762 (GRCm39) I210V possibly damaging Het
Tmprss9 T A 10: 80,719,555 (GRCm39) F93L possibly damaging Het
U2surp T C 9: 95,361,360 (GRCm39) Y633C probably damaging Het
Usp18 A T 6: 121,239,781 (GRCm39) E292V possibly damaging Het
Usp32 A C 11: 84,883,277 (GRCm39) probably null Het
Utp18 T C 11: 93,776,449 (GRCm39) D12G probably benign Het
Vmn1r216 C A 13: 23,283,928 (GRCm39) H204N probably benign Het
Wdr97 T C 15: 76,241,372 (GRCm39) V626A probably damaging Het
Wwc1 A T 11: 35,761,809 (GRCm39) V619E probably null Het
Wwc1 T C 11: 35,780,100 (GRCm39) D285G probably damaging Het
Zfp3 A T 11: 70,662,590 (GRCm39) Q183L probably benign Het
Zfp955a A G 17: 33,460,660 (GRCm39) C491R probably damaging Het
Other mutations in Abcb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Abcb4 APN 5 9,000,073 (GRCm39) missense probably benign 0.02
IGL00663:Abcb4 APN 5 8,977,916 (GRCm39) missense probably damaging 1.00
IGL00671:Abcb4 APN 5 8,980,745 (GRCm39) nonsense probably null
IGL00822:Abcb4 APN 5 9,000,046 (GRCm39) missense probably benign
IGL01080:Abcb4 APN 5 8,984,258 (GRCm39) missense probably damaging 1.00
IGL01152:Abcb4 APN 5 9,000,678 (GRCm39) missense probably benign 0.19
IGL01329:Abcb4 APN 5 8,944,166 (GRCm39) critical splice donor site probably null
IGL01483:Abcb4 APN 5 8,977,871 (GRCm39) missense probably damaging 0.99
IGL01594:Abcb4 APN 5 8,996,071 (GRCm39) splice site probably null
IGL01785:Abcb4 APN 5 8,965,058 (GRCm39) nonsense probably null
IGL01968:Abcb4 APN 5 8,977,913 (GRCm39) missense probably benign 0.33
IGL02579:Abcb4 APN 5 9,005,537 (GRCm39) missense probably damaging 1.00
IGL02654:Abcb4 APN 5 8,977,826 (GRCm39) missense possibly damaging 0.80
IGL02658:Abcb4 APN 5 8,984,240 (GRCm39) missense probably benign
IGL03229:Abcb4 APN 5 8,990,936 (GRCm39) missense probably damaging 0.97
IGL03335:Abcb4 APN 5 8,985,258 (GRCm39) missense probably benign 0.00
FR4737:Abcb4 UTSW 5 8,946,597 (GRCm39) small deletion probably benign
P0014:Abcb4 UTSW 5 9,000,083 (GRCm39) missense probably benign 0.01
R0102:Abcb4 UTSW 5 8,959,194 (GRCm39) missense probably damaging 0.99
R0102:Abcb4 UTSW 5 8,959,194 (GRCm39) missense probably damaging 0.99
R0309:Abcb4 UTSW 5 8,989,835 (GRCm39) missense probably damaging 1.00
R0311:Abcb4 UTSW 5 8,984,243 (GRCm39) missense probably benign
R0420:Abcb4 UTSW 5 8,991,050 (GRCm39) missense probably benign 0.03
R0449:Abcb4 UTSW 5 8,989,885 (GRCm39) nonsense probably null
R0609:Abcb4 UTSW 5 8,997,376 (GRCm39) missense probably damaging 0.96
R1459:Abcb4 UTSW 5 8,968,662 (GRCm39) missense possibly damaging 0.61
R1470:Abcb4 UTSW 5 8,990,968 (GRCm39) missense probably damaging 0.98
R1470:Abcb4 UTSW 5 8,990,968 (GRCm39) missense probably damaging 0.98
R1812:Abcb4 UTSW 5 8,978,578 (GRCm39) critical splice donor site probably null
R1944:Abcb4 UTSW 5 8,980,796 (GRCm39) missense probably damaging 1.00
R2002:Abcb4 UTSW 5 8,955,989 (GRCm39) missense probably benign 0.01
R2256:Abcb4 UTSW 5 9,008,431 (GRCm39) missense probably damaging 1.00
R3116:Abcb4 UTSW 5 8,946,610 (GRCm39) missense possibly damaging 0.86
R4112:Abcb4 UTSW 5 8,986,783 (GRCm39) critical splice acceptor site probably null
R4354:Abcb4 UTSW 5 8,968,771 (GRCm39) missense probably benign 0.44
R4512:Abcb4 UTSW 5 8,978,573 (GRCm39) missense probably damaging 1.00
R4588:Abcb4 UTSW 5 8,997,328 (GRCm39) missense probably benign 0.01
R4628:Abcb4 UTSW 5 8,957,399 (GRCm39) missense probably benign 0.08
R4708:Abcb4 UTSW 5 8,965,125 (GRCm39) missense possibly damaging 0.90
R4714:Abcb4 UTSW 5 8,980,906 (GRCm39) splice site probably null
R4754:Abcb4 UTSW 5 8,960,717 (GRCm39) missense probably damaging 1.00
R4846:Abcb4 UTSW 5 8,985,180 (GRCm39) missense probably benign
R4896:Abcb4 UTSW 5 8,957,267 (GRCm39) missense possibly damaging 0.81
R4944:Abcb4 UTSW 5 8,984,327 (GRCm39) critical splice donor site probably null
R4994:Abcb4 UTSW 5 8,978,524 (GRCm39) missense probably damaging 1.00
R5022:Abcb4 UTSW 5 8,959,054 (GRCm39) splice site probably null
R5537:Abcb4 UTSW 5 9,005,485 (GRCm39) missense probably damaging 0.98
R5754:Abcb4 UTSW 5 8,984,320 (GRCm39) missense probably benign
R5833:Abcb4 UTSW 5 9,008,314 (GRCm39) missense probably damaging 1.00
R5934:Abcb4 UTSW 5 8,980,806 (GRCm39) missense probably benign 0.18
R6146:Abcb4 UTSW 5 8,946,587 (GRCm39) missense probably benign 0.05
R6183:Abcb4 UTSW 5 8,968,718 (GRCm39) missense probably benign
R6260:Abcb4 UTSW 5 8,984,219 (GRCm39) nonsense probably null
R6561:Abcb4 UTSW 5 8,977,825 (GRCm39) missense probably benign 0.14
R7016:Abcb4 UTSW 5 8,986,843 (GRCm39) missense probably benign 0.35
R7081:Abcb4 UTSW 5 8,984,263 (GRCm39) missense probably benign
R7326:Abcb4 UTSW 5 8,984,226 (GRCm39) missense probably benign 0.00
R7375:Abcb4 UTSW 5 8,968,671 (GRCm39) missense probably benign
R7787:Abcb4 UTSW 5 8,959,220 (GRCm39) missense probably damaging 1.00
R7836:Abcb4 UTSW 5 8,984,203 (GRCm39) missense probably benign
R8128:Abcb4 UTSW 5 9,008,395 (GRCm39) missense probably damaging 1.00
R8350:Abcb4 UTSW 5 8,978,578 (GRCm39) critical splice donor site probably null
R8438:Abcb4 UTSW 5 8,996,120 (GRCm39) critical splice donor site probably null
R8447:Abcb4 UTSW 5 8,957,278 (GRCm39) missense probably damaging 0.97
R8710:Abcb4 UTSW 5 9,005,495 (GRCm39) missense probably damaging 1.00
R8777:Abcb4 UTSW 5 8,989,894 (GRCm39) missense probably benign 0.01
R8777-TAIL:Abcb4 UTSW 5 8,989,894 (GRCm39) missense probably benign 0.01
R8837:Abcb4 UTSW 5 8,986,873 (GRCm39) missense probably damaging 0.99
R8987:Abcb4 UTSW 5 8,977,931 (GRCm39) missense probably benign 0.02
R9098:Abcb4 UTSW 5 9,008,441 (GRCm39) missense probably damaging 1.00
R9167:Abcb4 UTSW 5 8,986,849 (GRCm39) nonsense probably null
R9210:Abcb4 UTSW 5 9,005,591 (GRCm39) missense probably damaging 1.00
R9212:Abcb4 UTSW 5 9,005,591 (GRCm39) missense probably damaging 1.00
R9218:Abcb4 UTSW 5 8,977,960 (GRCm39) missense probably benign 0.20
R9242:Abcb4 UTSW 5 8,949,677 (GRCm39) missense probably damaging 1.00
R9376:Abcb4 UTSW 5 9,008,988 (GRCm39) missense probably damaging 1.00
R9476:Abcb4 UTSW 5 8,977,790 (GRCm39) missense probably damaging 1.00
RF015:Abcb4 UTSW 5 8,946,594 (GRCm39) frame shift probably null
RF047:Abcb4 UTSW 5 8,946,595 (GRCm39) frame shift probably null
Z1176:Abcb4 UTSW 5 9,009,005 (GRCm39) missense probably damaging 1.00
Z1177:Abcb4 UTSW 5 8,989,906 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTATTCGCTTCCATGAGCACC -3'
(R):5'- TTCCGAGCAGACACGTCTAAATG -3'

Sequencing Primer
(F):5'- AGAGACTTAGCTACTCTACTGTGC -3'
(R):5'- TGCTCTCAAGGAACAGTAGC -3'
Posted On 2017-06-26