Incidental Mutation 'R6006:Abcb4'
ID479472
Institutional Source Beutler Lab
Gene Symbol Abcb4
Ensembl Gene ENSMUSG00000042476
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 4
SynonymsPgy-2, Mdr2, Pgy2, mdr-2
MMRRC Submission 044183-MU
Accession Numbers

Ncbi RefSeq: NM_008830; MGI: 97569

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6006 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location8893717-8959231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8946026 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 894 (T894K)
Ref Sequence ENSEMBL: ENSMUSP00000003717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003717] [ENSMUST00000196067]
Predicted Effect probably damaging
Transcript: ENSMUST00000003717
AA Change: T894K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003717
Gene: ENSMUSG00000042476
AA Change: T894K

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 342 2e-94 PFAM
AAA 418 610 3.97e-20 SMART
Pfam:ABC_membrane 708 982 6.3e-77 PFAM
AAA 1058 1246 4.49e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196067
SMART Domains Protein: ENSMUSP00000142425
Gene: ENSMUSG00000042476

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 344 2.4e-95 PFAM
AAA 418 610 6.2e-22 SMART
Pfam:ABC_membrane 708 882 1.6e-37 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype Strain: 1857236
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are unable to secrete phospholipids into bile, leading to progressive hepatic disease, with an end stage of 3 months. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Abcb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Abcb4 APN 5 8950073 missense probably benign 0.02
IGL00663:Abcb4 APN 5 8927916 missense probably damaging 1.00
IGL00671:Abcb4 APN 5 8930745 nonsense probably null
IGL00822:Abcb4 APN 5 8950046 missense probably benign
IGL01080:Abcb4 APN 5 8934258 missense probably damaging 1.00
IGL01152:Abcb4 APN 5 8950678 missense probably benign 0.19
IGL01329:Abcb4 APN 5 8894166 critical splice donor site probably null
IGL01483:Abcb4 APN 5 8927871 missense probably damaging 0.99
IGL01594:Abcb4 APN 5 8946071 unclassified probably null
IGL01785:Abcb4 APN 5 8915058 nonsense probably null
IGL01968:Abcb4 APN 5 8927913 missense probably benign 0.33
IGL02579:Abcb4 APN 5 8955537 missense probably damaging 1.00
IGL02654:Abcb4 APN 5 8927826 missense possibly damaging 0.80
IGL02658:Abcb4 APN 5 8934240 missense probably benign
IGL03229:Abcb4 APN 5 8940936 missense probably damaging 0.97
IGL03335:Abcb4 APN 5 8935258 missense probably benign 0.00
FR4737:Abcb4 UTSW 5 8896597 small deletion probably benign
P0014:Abcb4 UTSW 5 8950083 missense probably benign 0.01
R0102:Abcb4 UTSW 5 8909194 missense probably damaging 0.99
R0102:Abcb4 UTSW 5 8909194 missense probably damaging 0.99
R0309:Abcb4 UTSW 5 8939835 missense probably damaging 1.00
R0311:Abcb4 UTSW 5 8934243 missense probably benign
R0420:Abcb4 UTSW 5 8941050 missense probably benign 0.03
R0449:Abcb4 UTSW 5 8939885 nonsense probably null
R0609:Abcb4 UTSW 5 8947376 missense probably damaging 0.96
R1459:Abcb4 UTSW 5 8918662 missense possibly damaging 0.61
R1470:Abcb4 UTSW 5 8940968 missense probably damaging 0.98
R1470:Abcb4 UTSW 5 8940968 missense probably damaging 0.98
R1812:Abcb4 UTSW 5 8928578 critical splice donor site probably null
R1944:Abcb4 UTSW 5 8930796 missense probably damaging 1.00
R2002:Abcb4 UTSW 5 8905989 missense probably benign 0.01
R2256:Abcb4 UTSW 5 8958431 missense probably damaging 1.00
R3116:Abcb4 UTSW 5 8896610 missense possibly damaging 0.86
R4112:Abcb4 UTSW 5 8936783 critical splice acceptor site probably null
R4354:Abcb4 UTSW 5 8918771 missense probably benign 0.44
R4512:Abcb4 UTSW 5 8928573 missense probably damaging 1.00
R4588:Abcb4 UTSW 5 8947328 missense probably benign 0.01
R4628:Abcb4 UTSW 5 8907399 missense probably benign 0.08
R4708:Abcb4 UTSW 5 8915125 missense possibly damaging 0.90
R4714:Abcb4 UTSW 5 8930906 splice site probably null
R4754:Abcb4 UTSW 5 8910717 missense probably damaging 1.00
R4846:Abcb4 UTSW 5 8935180 missense probably benign
R4896:Abcb4 UTSW 5 8907267 missense possibly damaging 0.81
R4944:Abcb4 UTSW 5 8934327 critical splice donor site probably null
R4994:Abcb4 UTSW 5 8928524 missense probably damaging 1.00
R5022:Abcb4 UTSW 5 8909054 intron probably null
R5537:Abcb4 UTSW 5 8955485 missense probably damaging 0.98
R5754:Abcb4 UTSW 5 8934320 missense probably benign
R5833:Abcb4 UTSW 5 8958314 missense probably damaging 1.00
R5934:Abcb4 UTSW 5 8930806 missense probably benign 0.18
R6146:Abcb4 UTSW 5 8896587 missense probably benign 0.05
R6183:Abcb4 UTSW 5 8918718 missense probably benign
R6260:Abcb4 UTSW 5 8934219 nonsense probably null
R6561:Abcb4 UTSW 5 8927825 missense probably benign 0.14
R7016:Abcb4 UTSW 5 8936843 missense probably benign 0.35
R7081:Abcb4 UTSW 5 8934263 missense probably benign
R7326:Abcb4 UTSW 5 8934226 missense probably benign 0.00
R7375:Abcb4 UTSW 5 8918671 missense probably benign
R7787:Abcb4 UTSW 5 8909220 missense probably damaging 1.00
R7836:Abcb4 UTSW 5 8934203 missense probably benign
R7919:Abcb4 UTSW 5 8934203 missense probably benign
R8128:Abcb4 UTSW 5 8958395 missense probably damaging 1.00
RF015:Abcb4 UTSW 5 8896594 frame shift probably null
RF047:Abcb4 UTSW 5 8896595 frame shift probably null
Z1176:Abcb4 UTSW 5 8959005 missense probably damaging 1.00
Z1177:Abcb4 UTSW 5 8939906 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTATTCGCTTCCATGAGCACC -3'
(R):5'- TTCCGAGCAGACACGTCTAAATG -3'

Sequencing Primer
(F):5'- AGAGACTTAGCTACTCTACTGTGC -3'
(R):5'- TGCTCTCAAGGAACAGTAGC -3'
Posted On2017-06-26