Incidental Mutation 'R6006:Tigd2'
ID479476
Institutional Source Beutler Lab
Gene Symbol Tigd2
Ensembl Gene ENSMUSG00000049232
Gene Nametigger transposable element derived 2
Synonyms3632410O17Rik
MMRRC Submission 044183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6006 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location59208870-59212033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59210777 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 210 (I210V)
Ref Sequence ENSEMBL: ENSMUSP00000057223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062626]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062626
AA Change: I210V

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057223
Gene: ENSMUSG00000049232
AA Change: I210V

DomainStartEndE-ValueType
Pfam:CENP-B_N 4 54 6e-17 PFAM
CENPB 73 139 5.78e-19 SMART
Pfam:DDE_1 206 385 2.2e-52 PFAM
low complexity region 504 519 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Tigd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02304:Tigd2 APN 6 59211698 nonsense probably null
IGL03356:Tigd2 APN 6 59211705 missense probably benign 0.04
PIT1430001:Tigd2 UTSW 6 59211248 missense probably damaging 1.00
R0048:Tigd2 UTSW 6 59211384 missense possibly damaging 0.86
R0387:Tigd2 UTSW 6 59211158 missense probably benign 0.00
R0523:Tigd2 UTSW 6 59210373 missense probably benign 0.30
R0636:Tigd2 UTSW 6 59211287 missense possibly damaging 0.66
R1171:Tigd2 UTSW 6 59211376 missense possibly damaging 0.73
R2440:Tigd2 UTSW 6 59209995 start gained probably benign
R4327:Tigd2 UTSW 6 59210577 missense probably benign 0.36
R4731:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R4732:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R4733:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R5005:Tigd2 UTSW 6 59211146 missense probably benign 0.06
R5028:Tigd2 UTSW 6 59211220 nonsense probably null
R5248:Tigd2 UTSW 6 59211153 missense probably damaging 1.00
R7099:Tigd2 UTSW 6 59210181 missense probably damaging 1.00
R7261:Tigd2 UTSW 6 59211067 missense probably benign 0.02
R7553:Tigd2 UTSW 6 59211579 missense probably benign 0.04
R7688:Tigd2 UTSW 6 59210397 missense probably damaging 1.00
R8002:Tigd2 UTSW 6 59210509 missense probably damaging 1.00
Z1177:Tigd2 UTSW 6 59211530 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTATTCCAAAGGCTGCAGGG -3'
(R):5'- CTGCTCGGTAATATCTTTTGACTG -3'

Sequencing Primer
(F):5'- GGGGATGAAACTGCTGCC -3'
(R):5'- CCCTGGCTCATAGGTTGAATTAGAC -3'
Posted On2017-06-26