Incidental Mutation 'R6006:Usp18'
ID479478
Institutional Source Beutler Lab
Gene Symbol Usp18
Ensembl Gene ENSMUSG00000030107
Gene Nameubiquitin specific peptidase 18
Synonyms1110058H21Rik, UBP43
MMRRC Submission 044183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6006 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location121245906-121270917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121262822 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 292 (E292V)
Ref Sequence ENSEMBL: ENSMUSP00000032198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032198
AA Change: E292V

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032198
Gene: ENSMUSG00000030107
AA Change: E292V

DomainStartEndE-ValueType
Pfam:UCH 51 363 3.1e-41 PFAM
Pfam:UCH_1 52 335 6.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204926
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiquitin-specific proteases (UBP) family of enzymes that cleave ubiquitin from ubiquitinated protein substrates. It is highly expressed in liver and thymus, and is localized to the nucleus. This protein efficiently cleaves only ISG15 (a ubiquitin-like protein) fusions, and deletion of this gene in mice results in a massive increase of ISG15 conjugates in tissues, indicating that this protein is a major ISG15-specific protease. Mice lacking this gene are also hypersensitive to interferon, suggesting a function of this protein in downregulating interferon responses, independent of its isopeptidase activity towards ISG15. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mutants die prematurely with cellular necrosis in the ependyma, breakdown of blood-brain barrier, hydrocephaly with enlarged ventricles, and severe neurological abnormalities. Mice homozygous for an ENU-induced allele exhibit increased susceptibility to Salmonella infection and LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Usp18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Usp18 APN 6 121255382 nonsense probably null
IGL01403:Usp18 APN 6 121268668 missense possibly damaging 0.67
IGL01411:Usp18 APN 6 121261421 missense probably benign 0.01
IGL01810:Usp18 APN 6 121253771 missense probably damaging 1.00
IGL02568:Usp18 APN 6 121261091 missense probably benign 0.00
IGL02613:Usp18 APN 6 121261090 missense probably benign 0.11
R0961:Usp18 UTSW 6 121261493 missense probably benign 0.00
R1350:Usp18 UTSW 6 121262692 missense possibly damaging 0.64
R1855:Usp18 UTSW 6 121262117 missense probably benign 0.07
R1916:Usp18 UTSW 6 121268554 missense probably benign 0.14
R1981:Usp18 UTSW 6 121252517 missense probably benign 0.08
R2015:Usp18 UTSW 6 121268550 missense probably damaging 1.00
R4062:Usp18 UTSW 6 121261367 missense probably benign
R5000:Usp18 UTSW 6 121252520 missense possibly damaging 0.84
R5894:Usp18 UTSW 6 121261497 missense probably benign 0.03
R6932:Usp18 UTSW 6 121252514 missense probably benign 0.01
R7357:Usp18 UTSW 6 121253849 missense possibly damaging 0.90
Z1177:Usp18 UTSW 6 121255275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCCTGTGCCCAAAGATTTC -3'
(R):5'- ACGATGCTGGTCCATATCAC -3'

Sequencing Primer
(F):5'- AGATTTCATCTTCATTCTGATTTTGC -3'
(R):5'- ACCTCACAGTTGGCTGAGTTACAG -3'
Posted On2017-06-26