Incidental Mutation 'R6006:Olfr670'
ID479481
Institutional Source Beutler Lab
Gene Symbol Olfr670
Ensembl Gene ENSMUSG00000044705
Gene Nameolfactory receptor 670
SynonymsMOR32-8, GA_x6K02T2PBJ9-7589577-7588639
MMRRC Submission 044183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6006 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104957114-104962620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 104960663 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 23 (E23A)
Ref Sequence ENSEMBL: ENSMUSP00000151138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050482] [ENSMUST00000214216]
Predicted Effect probably damaging
Transcript: ENSMUST00000050482
AA Change: E23A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060289
Gene: ENSMUSG00000044705
AA Change: E23A

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 3.7e-121 PFAM
Pfam:7TM_GPCR_Srsx 37 211 4.5e-7 PFAM
Pfam:7tm_1 43 293 3.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214216
AA Change: E23A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Olfr670
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Olfr670 APN 7 104960716 missense probably damaging 0.96
IGL01100:Olfr670 APN 7 104959995 missense probably benign 0.07
IGL01351:Olfr670 APN 7 104960739 start gained probably benign
IGL01478:Olfr670 APN 7 104960348 missense probably damaging 0.97
IGL01835:Olfr670 APN 7 104960462 missense probably benign 0.01
IGL02326:Olfr670 APN 7 104960646 missense probably benign 0.12
IGL02434:Olfr670 APN 7 104960072 missense probably benign 0.05
IGL02434:Olfr670 APN 7 104960074 nonsense probably null
IGL02968:Olfr670 APN 7 104960244 missense possibly damaging 0.90
R0055:Olfr670 UTSW 7 104960496 missense possibly damaging 0.46
R0055:Olfr670 UTSW 7 104960496 missense possibly damaging 0.46
R0345:Olfr670 UTSW 7 104960181 missense probably damaging 1.00
R0401:Olfr670 UTSW 7 104959943 missense probably damaging 1.00
R0646:Olfr670 UTSW 7 104959811 missense probably benign 0.02
R1493:Olfr670 UTSW 7 104960502 missense probably damaging 0.97
R1532:Olfr670 UTSW 7 104960265 missense probably benign
R1557:Olfr670 UTSW 7 104960540 missense probably damaging 0.99
R4072:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4074:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4075:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4076:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4229:Olfr670 UTSW 7 104960594 missense probably benign 0.18
R4230:Olfr670 UTSW 7 104960594 missense probably benign 0.18
R5374:Olfr670 UTSW 7 104959996 missense probably damaging 1.00
R6891:Olfr670 UTSW 7 104959985 missense probably damaging 1.00
R7465:Olfr670 UTSW 7 104959917 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ACATCTGGGTCACACATCCC -3'
(R):5'- AGGGCCTTTATCATAATAGGTGTG -3'

Sequencing Primer
(F):5'- GCCCAGCATCTTGGGAATTG -3'
(R):5'- ATCATAATAGGTGTGTTTGTGTGC -3'
Posted On2017-06-26