Incidental Mutation 'R6006:Adamts18'
ID479482
Institutional Source Beutler Lab
Gene Symbol Adamts18
Ensembl Gene ENSMUSG00000053399
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18
SynonymsE130314N14Rik
MMRRC Submission 044183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6006 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location113697126-113848738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113706974 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1043 (C1043S)
Ref Sequence ENSEMBL: ENSMUSP00000090801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]
Predicted Effect probably damaging
Transcript: ENSMUST00000093113
AA Change: C1043S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: C1043S

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Pfam:Pep_M12B_propep 63 203 3.4e-37 PFAM
Pfam:Reprolysin_5 292 473 1.3e-14 PFAM
Pfam:Reprolysin_4 294 494 2.6e-11 PFAM
Pfam:Reprolysin 294 498 2.7e-30 PFAM
Pfam:Reprolysin_2 311 488 1.7e-14 PFAM
Pfam:Reprolysin_3 315 447 1.5e-11 PFAM
TSP1 592 644 7.37e-17 SMART
Pfam:ADAM_spacer1 749 861 1.7e-38 PFAM
TSP1 878 932 1.55e-1 SMART
TSP1 934 992 5.07e-6 SMART
TSP1 994 1049 1.65e-5 SMART
TSP1 1055 1116 1.71e-3 SMART
TSP1 1125 1171 5.27e-4 SMART
Pfam:PLAC 1186 1216 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212437
Predicted Effect probably benign
Transcript: ENSMUST00000212665
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Adamts18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Adamts18 APN 8 113774943 missense probably damaging 1.00
IGL01548:Adamts18 APN 8 113764299 missense probably damaging 1.00
IGL01556:Adamts18 APN 8 113845109 missense probably benign 0.01
IGL01833:Adamts18 APN 8 113743096 missense probably benign 0.10
IGL02187:Adamts18 APN 8 113713194 missense possibly damaging 0.93
IGL02551:Adamts18 APN 8 113699072 missense probably damaging 1.00
IGL02756:Adamts18 APN 8 113714344 splice site probably benign
IGL03188:Adamts18 APN 8 113699024 missense probably damaging 1.00
IGL03411:Adamts18 APN 8 113764297 nonsense probably null
R0119:Adamts18 UTSW 8 113774953 missense possibly damaging 0.94
R0378:Adamts18 UTSW 8 113743117 missense probably damaging 1.00
R0410:Adamts18 UTSW 8 113714358 nonsense probably null
R0480:Adamts18 UTSW 8 113738818 missense possibly damaging 0.93
R0514:Adamts18 UTSW 8 113738769 intron probably null
R0924:Adamts18 UTSW 8 113705396 splice site probably null
R0930:Adamts18 UTSW 8 113705396 splice site probably null
R1333:Adamts18 UTSW 8 113705173 splice site probably benign
R1441:Adamts18 UTSW 8 113754562 critical splice donor site probably null
R2082:Adamts18 UTSW 8 113775333 missense probably damaging 1.00
R2146:Adamts18 UTSW 8 113845003 missense possibly damaging 0.58
R2371:Adamts18 UTSW 8 113705261 missense probably benign 0.36
R3148:Adamts18 UTSW 8 113738858 missense probably damaging 1.00
R3963:Adamts18 UTSW 8 113777811 missense probably benign 0.00
R4056:Adamts18 UTSW 8 113737580 nonsense probably null
R4486:Adamts18 UTSW 8 113713193 missense probably benign 0.00
R4608:Adamts18 UTSW 8 113737613 missense probably damaging 1.00
R4624:Adamts18 UTSW 8 113773168 nonsense probably null
R4626:Adamts18 UTSW 8 113773168 nonsense probably null
R4627:Adamts18 UTSW 8 113773168 nonsense probably null
R4628:Adamts18 UTSW 8 113773168 nonsense probably null
R4629:Adamts18 UTSW 8 113773168 nonsense probably null
R4710:Adamts18 UTSW 8 113706926 missense probably damaging 0.98
R4959:Adamts18 UTSW 8 113736725 nonsense probably null
R4973:Adamts18 UTSW 8 113736725 nonsense probably null
R4976:Adamts18 UTSW 8 113699010 missense probably benign 0.31
R5119:Adamts18 UTSW 8 113699010 missense probably benign 0.31
R5141:Adamts18 UTSW 8 113775270 missense probably damaging 1.00
R5422:Adamts18 UTSW 8 113698974 missense probably benign 0.06
R5587:Adamts18 UTSW 8 113775360 nonsense probably null
R5868:Adamts18 UTSW 8 113777748 missense possibly damaging 0.69
R5893:Adamts18 UTSW 8 113773077 missense probably damaging 1.00
R5906:Adamts18 UTSW 8 113709619 missense probably benign 0.00
R5942:Adamts18 UTSW 8 113777748 missense probably benign 0.01
R6608:Adamts18 UTSW 8 113775279 missense probably damaging 1.00
R6725:Adamts18 UTSW 8 113743201 missense probably damaging 1.00
R7002:Adamts18 UTSW 8 113775290 missense possibly damaging 0.69
R7276:Adamts18 UTSW 8 113775264 missense probably damaging 0.99
R7292:Adamts18 UTSW 8 113709645 missense probably benign 0.00
R7411:Adamts18 UTSW 8 113777730 missense probably damaging 0.99
R7685:Adamts18 UTSW 8 113713223 missense probably damaging 1.00
R7737:Adamts18 UTSW 8 113736934 splice site probably null
R7860:Adamts18 UTSW 8 113775276 missense probably damaging 1.00
R7943:Adamts18 UTSW 8 113775276 missense probably damaging 1.00
Z1088:Adamts18 UTSW 8 113775440 missense possibly damaging 0.86
Z1176:Adamts18 UTSW 8 113743168 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACAGCAATAGATAAGCACCTGG -3'
(R):5'- AGAGGGAGCTAACAATTCCATTAC -3'

Sequencing Primer
(F):5'- GCACCTGGCACATGTATGC -3'
(R):5'- CTCAGTGTTTATCCAACTGAAATCC -3'
Posted On2017-06-26