Incidental Mutation 'R6006:Abcb10'
ID479483
Institutional Source Beutler Lab
Gene Symbol Abcb10
Ensembl Gene ENSMUSG00000031974
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 10
SynonymsABC-me
MMRRC Submission 044183-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6006 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location123952459-123983122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123968065 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 296 (I296T)
Ref Sequence ENSEMBL: ENSMUSP00000075011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075578] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000075578
AA Change: I296T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000075011
Gene: ENSMUSG00000031974
AA Change: I296T

DomainStartEndE-ValueType
Pfam:ABC_membrane 136 407 1.7e-60 PFAM
AAA 484 675 1.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ATP-binding cassette superfamily of transporters. ATP-binding cassette proteins transport various molecules across extra- and intra-cellular membranes. The encoded protein is localized to the mitochondrial inner membrane where it interacts with and stabilizes mitoferrin-1, and is important for heme biosynthesis. Additional evidence suggests the encoded protein is involved in oxidative stress protection and erythropoisesis. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit increased response to ischemia and reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Abcb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Abcb10 APN 8 123954427 missense probably benign 0.00
IGL02279:Abcb10 APN 8 123954361 missense probably benign 0.17
IGL02302:Abcb10 APN 8 123958672 missense possibly damaging 0.89
IGL02342:Abcb10 APN 8 123962034 missense probably damaging 1.00
IGL03062:Abcb10 APN 8 123954315 missense possibly damaging 0.49
IGL03409:Abcb10 APN 8 123965023 missense possibly damaging 0.63
R0320:Abcb10 UTSW 8 123963007 missense probably benign 0.00
R0436:Abcb10 UTSW 8 123971001 missense probably benign 0.01
R1074:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1224:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1225:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1226:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1251:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1252:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1254:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1255:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1256:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1355:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1370:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1424:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1499:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1769:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R2096:Abcb10 UTSW 8 123982456 missense probably benign 0.01
R2125:Abcb10 UTSW 8 123965092 missense probably benign 0.29
R2274:Abcb10 UTSW 8 123982752 missense probably benign 0.23
R4801:Abcb10 UTSW 8 123966527 missense probably benign 0.12
R4802:Abcb10 UTSW 8 123966527 missense probably benign 0.12
R4850:Abcb10 UTSW 8 123982690 missense probably benign 0.01
R5320:Abcb10 UTSW 8 123971024 missense probably benign 0.11
R5947:Abcb10 UTSW 8 123967998 splice site probably null
R6328:Abcb10 UTSW 8 123962017 missense probably damaging 1.00
R7168:Abcb10 UTSW 8 123966611 missense
R8130:Abcb10 UTSW 8 123965018 missense
R8131:Abcb10 UTSW 8 123965018 missense
R8132:Abcb10 UTSW 8 123965018 missense
V7581:Abcb10 UTSW 8 123969761 intron probably benign
Z1176:Abcb10 UTSW 8 123982663 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTAGACTGTCTCACTGTCCTG -3'
(R):5'- AGAAAGCTTGGTTTGGGGAC -3'

Sequencing Primer
(F):5'- CAAGGAAGGACTTAGTTGCTCATTTC -3'
(R):5'- GACTGTCTCTTGGCTGCACATG -3'
Posted On2017-06-26