Incidental Mutation 'R6006:U2surp'
ID479485
Institutional Source Beutler Lab
Gene Symbol U2surp
Ensembl Gene ENSMUSG00000032407
Gene NameU2 snRNP-associated SURP domain containing
Synonyms2610101N10Rik
MMRRC Submission 044183-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R6006 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location95456898-95511996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95479307 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 633 (Y633C)
Ref Sequence ENSEMBL: ENSMUSP00000151121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078374] [ENSMUST00000079659] [ENSMUST00000191213] [ENSMUST00000217176]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078374
AA Change: Y590C

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077482
Gene: ENSMUSG00000032407
AA Change: Y590C

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
coiled coil region 148 186 N/A INTRINSIC
RRM 231 307 1.85e-18 SMART
low complexity region 313 323 N/A INTRINSIC
SWAP 384 438 1.07e-20 SMART
RPR 493 632 1.42e-41 SMART
internal_repeat_1 648 665 6.09e-7 PROSPERO
internal_repeat_1 678 698 6.09e-7 PROSPERO
coiled coil region 742 769 N/A INTRINSIC
cwf21 792 843 6.31e-17 SMART
low complexity region 881 933 N/A INTRINSIC
low complexity region 939 985 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079659
AA Change: Y634C

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078602
Gene: ENSMUSG00000032407
AA Change: Y634C

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 1.85e-18 SMART
low complexity region 357 367 N/A INTRINSIC
SWAP 428 482 1.07e-20 SMART
RPR 537 676 1.42e-41 SMART
internal_repeat_1 692 709 1.14e-6 PROSPERO
internal_repeat_1 722 742 1.14e-6 PROSPERO
coiled coil region 786 813 N/A INTRINSIC
cwf21 836 887 6.31e-17 SMART
low complexity region 925 977 N/A INTRINSIC
low complexity region 983 1029 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186139
Predicted Effect probably benign
Transcript: ENSMUST00000191213
SMART Domains Protein: ENSMUSP00000140614
Gene: ENSMUSG00000032407

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 7.8e-21 SMART
low complexity region 357 367 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217176
AA Change: Y633C

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in U2surp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:U2surp APN 9 95461524 utr 3 prime probably benign
IGL01122:U2surp APN 9 95490234 missense probably benign 0.02
IGL01985:U2surp APN 9 95490226 missense probably damaging 1.00
IGL01992:U2surp APN 9 95464419 missense possibly damaging 0.46
IGL01992:U2surp APN 9 95482181 missense probably damaging 0.99
IGL02300:U2surp APN 9 95488770 missense probably damaging 1.00
IGL02491:U2surp APN 9 95490220 missense probably damaging 0.98
IGL02503:U2surp APN 9 95502569 missense probably benign 0.03
IGL02615:U2surp APN 9 95493231 missense probably benign 0.00
IGL02628:U2surp APN 9 95472090 missense possibly damaging 0.89
IGL02682:U2surp APN 9 95481651 critical splice donor site probably null
IGL02721:U2surp APN 9 95474435 missense probably benign 0.10
IGL03200:U2surp APN 9 95491391 nonsense probably null
coup UTSW 9 95477512 missense probably damaging 1.00
R0095:U2surp UTSW 9 95500684 splice site probably null
R0373:U2surp UTSW 9 95484443 missense probably benign 0.08
R0376:U2surp UTSW 9 95484443 missense probably benign 0.08
R0377:U2surp UTSW 9 95484443 missense probably benign 0.08
R0416:U2surp UTSW 9 95485607 missense probably damaging 1.00
R0682:U2surp UTSW 9 95484443 missense probably benign 0.08
R0948:U2surp UTSW 9 95461497 utr 3 prime probably benign
R1420:U2surp UTSW 9 95462803 missense probably benign 0.33
R1474:U2surp UTSW 9 95493198 missense possibly damaging 0.49
R1555:U2surp UTSW 9 95466577 missense probably damaging 1.00
R1597:U2surp UTSW 9 95481740 splice site probably benign
R1638:U2surp UTSW 9 95484227 missense possibly damaging 0.95
R1693:U2surp UTSW 9 95511860 start codon destroyed probably null 0.53
R1851:U2surp UTSW 9 95482097 nonsense probably null
R2271:U2surp UTSW 9 95491420 missense possibly damaging 0.80
R2679:U2surp UTSW 9 95476232 missense possibly damaging 0.82
R2851:U2surp UTSW 9 95500682 splice site probably null
R3769:U2surp UTSW 9 95493697 splice site probably benign
R4596:U2surp UTSW 9 95485628 missense probably damaging 1.00
R4672:U2surp UTSW 9 95493145 missense possibly damaging 0.83
R4763:U2surp UTSW 9 95511791 intron probably benign
R4995:U2surp UTSW 9 95462794 utr 3 prime probably benign
R5805:U2surp UTSW 9 95479304 missense possibly damaging 0.51
R6249:U2surp UTSW 9 95500816 missense probably benign 0.07
R6260:U2surp UTSW 9 95476157 missense probably damaging 0.99
R6378:U2surp UTSW 9 95491421 missense probably benign 0.41
R6487:U2surp UTSW 9 95477512 missense probably damaging 1.00
R6585:U2surp UTSW 9 95472071 missense probably damaging 1.00
R6721:U2surp UTSW 9 95491104 missense probably damaging 0.99
R6760:U2surp UTSW 9 95493711 missense probably benign 0.27
R7065:U2surp UTSW 9 95485659 missense probably benign 0.01
R7167:U2surp UTSW 9 95481673 missense probably damaging 0.98
R7219:U2surp UTSW 9 95490162 nonsense probably null
R7232:U2surp UTSW 9 95493717 missense probably benign 0.03
R7460:U2surp UTSW 9 95462824 missense unknown
R7547:U2surp UTSW 9 95479349 missense possibly damaging 0.94
R7609:U2surp UTSW 9 95485679 splice site probably null
R7761:U2surp UTSW 9 95488761 missense probably damaging 1.00
X0018:U2surp UTSW 9 95475288 missense probably benign 0.14
X0018:U2surp UTSW 9 95485597 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCCTGAAGATACTTTCTAAACAAC -3'
(R):5'- GACACAAAGGGCCAGATTGC -3'

Sequencing Primer
(F):5'- ATGAGGACCTGAGTTCAGCTCTC -3'
(R):5'- GGGCCAGATTGCTAAATTCATCC -3'
Posted On2017-06-26