Mutagenetix > Incidental Mutation

Incidental Mutation 'R6006:Lats1'

479486

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

044183-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R6006 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 7705595 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 715 (F715L)

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040043
AA Change: F715L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: F715L

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165952
AA Change: F715L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: F715L

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217931
AA Change: F715L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.3%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	A	G	8: 123,968,065	I296T	probably benign	Het
Abcb4	C	A	5: 8,946,026	T894K	probably damaging	Het
Acad12	C	T	5: 121,599,236	V491I	possibly damaging	Het
Actr8	T	A	14: 29,984,142		probably null	Het
Adam7	A	C	14: 68,511,396	D467E	probably damaging	Het
Adamts18	A	T	8: 113,706,974	C1043S	probably damaging	Het
Adgrb3	T	G	1: 25,826,531	D77A	possibly damaging	Het
Arhgap20	T	A	9: 51,850,126	D1056E	probably benign	Het
Bco1	A	G	8: 117,113,591		probably null	Het
Btn2a2	A	T	13: 23,486,363	W67R	probably damaging	Het
Camkmt	A	T	17: 85,452,238	N269Y	possibly damaging	Het
Cand1	A	G	10: 119,210,028	F991L	possibly damaging	Het
Cchcr1	A	G	17: 35,524,700	K234E	possibly damaging	Het
Cd14	T	C	18: 36,726,282	D40G	possibly damaging	Het
Cdc73	A	T	1: 143,617,439	F386I	probably damaging	Het
Cdk14	C	T	5: 5,249,211	M1I	probably null	Het
Cnpy3	A	C	17: 46,736,864	S220A	probably benign	Het
Col22a1	A	G	15: 71,973,836	V359A	probably damaging	Het
Col6a3	C	A	1: 90,768,383	C2654F	unknown	Het
Colgalt2	A	G	1: 152,473,161	T186A	probably damaging	Het
Cpsf4l	A	G	11: 113,699,927	V199A	probably benign	Het
Dhtkd1	G	A	2: 5,904,025	Q753*	probably null	Het
Ep400	A	G	5: 110,704,959	S1307P	unknown	Het
Fer1l6	T	C	15: 58,647,044	V1675A	probably damaging	Het
Glis1	T	C	4: 107,567,906	L238P	probably damaging	Het
Gm35339	T	C	15: 76,357,172	V626A	probably damaging	Het
Iqgap3	T	A	3: 88,091,547	D318E	probably damaging	Het
Mlxip	T	C	5: 123,445,658	F428S	possibly damaging	Het
Morc3	T	G	16: 93,866,493	I528R	possibly damaging	Het
Mtx1	C	T	3: 89,210,306	G60D	probably damaging	Het
Mug2	G	C	6: 122,083,500	Q1398H	probably null	Het
Mup8	T	C	4: 60,220,403	I110V	probably benign	Het
Nfkb1	A	T	3: 135,603,761	L12*	probably null	Het
Numa1	G	A	7: 101,992,719		probably null	Het
Olfr670	T	G	7: 104,960,663	E23A	probably damaging	Het
Pbk	C	T	14: 65,816,645	P213L	probably damaging	Het
Pdcd1lg2	T	A	19: 29,454,505	H224Q	possibly damaging	Het
Pkp1	C	G	1: 135,877,668		probably null	Het
Rela	A	G	19: 5,639,939	N139S	probably damaging	Het
Rgs3	G	A	4: 62,623,906	R39Q	probably damaging	Het
S1pr3	A	G	13: 51,419,695	E304G	probably damaging	Het
Sertad2	G	A	11: 20,647,884	G27S	probably benign	Het
Setmar	T	C	6: 108,076,426	S294P	possibly damaging	Het
Smc2	A	G	4: 52,459,024	N473S	probably benign	Het
Ssr1	TCTCTTTC	T	13: 37,985,996		probably null	Het
Tigd2	A	G	6: 59,210,777	I210V	possibly damaging	Het
Tmprss9	T	A	10: 80,883,721	F93L	possibly damaging	Het
Ttc30a1	A	G	2: 75,981,488	Y84H	probably benign	Het
U2surp	T	C	9: 95,479,307	Y633C	probably damaging	Het
Usp18	A	T	6: 121,262,822	E292V	possibly damaging	Het
Usp32	A	C	11: 84,992,451		probably null	Het
Utp18	T	C	11: 93,885,623	D12G	probably benign	Het
Vmn1r216	C	A	13: 23,099,758	H204N	probably benign	Het
Wwc1	A	T	11: 35,870,982	V619E	probably null	Het
Wwc1	T	C	11: 35,889,273	D285G	probably damaging	Het
Zfp3	A	T	11: 70,771,764	Q183L	probably benign	Het
Zfp955a	A	G	17: 33,241,686	C491R	probably damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTGCATTGTTTCTTAAGCTATG -3'
(R):5'- GTCCATCACAAAGTACAAGTTGTCC -3'

Sequencing Primer
(F):5'- GCATTGTTTCTTAAGCTATGTCTTAC -3'
(R):5'- CCTTGTCCTGGAAAGAGTAGTAC -3'

Posted On

2017-06-26