Incidental Mutation 'R6006:Tmprss9'
ID479487
Institutional Source Beutler Lab
Gene Symbol Tmprss9
Ensembl Gene ENSMUSG00000059406
Gene Nametransmembrane protease, serine 9
SynonymsSerase-1B
MMRRC Submission 044183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6006 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80871848-80899492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80883721 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 93 (F93L)
Ref Sequence ENSEMBL: ENSMUSP00000152034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105333] [ENSMUST00000219817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105333
AA Change: F93L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100970
Gene: ENSMUSG00000059406
AA Change: F93L

DomainStartEndE-ValueType
Pfam:SEA 62 155 1.7e-10 PFAM
LDLa 189 227 1.15e-4 SMART
Tryp_SPc 238 467 2.43e-96 SMART
low complexity region 477 502 N/A INTRINSIC
Tryp_SPc 539 767 7.28e-86 SMART
Tryp_SPc 867 1093 1.62e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219742
Predicted Effect possibly damaging
Transcript: ENSMUST00000219817
AA Change: F93L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound type II serine polyprotease that is cleaved to release three different proteases. Two of the proteases are active and can be inhibited by serine protease inhibitors, and one is thought to be catalytically inactive. This gene enhances the invasive capability of pancreatic cancer cells and may be involved in cancer progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Tmprss9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tmprss9 APN 10 80894428 critical splice donor site probably null
IGL00990:Tmprss9 APN 10 80892292 missense possibly damaging 0.92
IGL01710:Tmprss9 APN 10 80897959 unclassified probably benign
IGL03075:Tmprss9 APN 10 80884029 missense possibly damaging 0.77
IGL03132:Tmprss9 APN 10 80894865 missense probably damaging 0.98
R0142:Tmprss9 UTSW 10 80894378 missense possibly damaging 0.92
R0546:Tmprss9 UTSW 10 80899323 missense probably benign 0.00
R1171:Tmprss9 UTSW 10 80879858 missense possibly damaging 0.92
R1296:Tmprss9 UTSW 10 80890445 missense probably benign 0.02
R1302:Tmprss9 UTSW 10 80895129 missense probably benign 0.00
R1498:Tmprss9 UTSW 10 80895100 missense probably benign 0.01
R1706:Tmprss9 UTSW 10 80898187 unclassified probably benign
R1851:Tmprss9 UTSW 10 80892285 missense probably damaging 0.98
R2096:Tmprss9 UTSW 10 80889434 missense probably damaging 1.00
R2198:Tmprss9 UTSW 10 80887459 missense probably damaging 1.00
R3783:Tmprss9 UTSW 10 80887467 missense probably damaging 1.00
R5682:Tmprss9 UTSW 10 80897373 splice site probably null
R5868:Tmprss9 UTSW 10 80882746 missense probably benign 0.03
R6542:Tmprss9 UTSW 10 80888555 missense probably damaging 1.00
R6676:Tmprss9 UTSW 10 80898311 unclassified probably benign
R6718:Tmprss9 UTSW 10 80890364 missense probably benign
R7062:Tmprss9 UTSW 10 80895049 missense probably benign 0.00
R7316:Tmprss9 UTSW 10 80894979 missense probably benign 0.00
R7337:Tmprss9 UTSW 10 80882670 missense probably benign 0.00
R7624:Tmprss9 UTSW 10 80892219 missense possibly damaging 0.77
R7659:Tmprss9 UTSW 10 80893009 missense probably damaging 0.97
R7770:Tmprss9 UTSW 10 80898069 synonymous probably null
R7810:Tmprss9 UTSW 10 80897311 missense unknown
X0062:Tmprss9 UTSW 10 80883938 splice site probably null
X0066:Tmprss9 UTSW 10 80893230 missense probably damaging 0.99
Z1176:Tmprss9 UTSW 10 80888422 missense probably damaging 0.98
Z1177:Tmprss9 UTSW 10 80887522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTCTCTGTGGTTATAGCTTGGAAG -3'
(R):5'- TGCCATCCCTACATGCAAGAG -3'

Sequencing Primer
(F):5'- CACAGCTGAGTAATATTCCATTCC -3'
(R):5'- GCTCACAGCTGGGAATCTTC -3'
Posted On2017-06-26