Incidental Mutation 'R6006:Usp32'
ID 479493
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 2900074J03Rik, 6430526O11Rik
MMRRC Submission 044183-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6006 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84875268-85030987 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 84883277 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108075
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173156
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 124,694,804 (GRCm39) I296T probably benign Het
Abcb4 C A 5: 8,996,026 (GRCm39) T894K probably damaging Het
Acad12 C T 5: 121,737,299 (GRCm39) V491I possibly damaging Het
Actr8 T A 14: 29,706,099 (GRCm39) probably null Het
Adam7 A C 14: 68,748,845 (GRCm39) D467E probably damaging Het
Adamts18 A T 8: 114,433,606 (GRCm39) C1043S probably damaging Het
Adgrb3 T G 1: 25,865,612 (GRCm39) D77A possibly damaging Het
Arhgap20 T A 9: 51,761,426 (GRCm39) D1056E probably benign Het
Bco1 A G 8: 117,840,330 (GRCm39) probably null Het
Btn2a2 A T 13: 23,670,533 (GRCm39) W67R probably damaging Het
Camkmt A T 17: 85,759,666 (GRCm39) N269Y possibly damaging Het
Cand1 A G 10: 119,045,933 (GRCm39) F991L possibly damaging Het
Cchcr1 A G 17: 35,835,597 (GRCm39) K234E possibly damaging Het
Cd14 T C 18: 36,859,335 (GRCm39) D40G possibly damaging Het
Cdc73 A T 1: 143,493,177 (GRCm39) F386I probably damaging Het
Cdk14 C T 5: 5,299,211 (GRCm39) M1I probably null Het
Cnpy3 A C 17: 47,047,790 (GRCm39) S220A probably benign Het
Col22a1 A G 15: 71,845,685 (GRCm39) V359A probably damaging Het
Col6a3 C A 1: 90,696,105 (GRCm39) C2654F unknown Het
Colgalt2 A G 1: 152,348,912 (GRCm39) T186A probably damaging Het
Cpsf4l A G 11: 113,590,753 (GRCm39) V199A probably benign Het
Dhtkd1 G A 2: 5,908,836 (GRCm39) Q753* probably null Het
Ep400 A G 5: 110,852,825 (GRCm39) S1307P unknown Het
Fer1l6 T C 15: 58,518,893 (GRCm39) V1675A probably damaging Het
Glis1 T C 4: 107,425,103 (GRCm39) L238P probably damaging Het
Ift70a1 A G 2: 75,811,832 (GRCm39) Y84H probably benign Het
Iqgap3 T A 3: 87,998,854 (GRCm39) D318E probably damaging Het
Lats1 T C 10: 7,581,359 (GRCm39) F715L probably damaging Het
Mlxip T C 5: 123,583,721 (GRCm39) F428S possibly damaging Het
Morc3 T G 16: 93,663,381 (GRCm39) I528R possibly damaging Het
Mtx1 C T 3: 89,117,613 (GRCm39) G60D probably damaging Het
Mug2 G C 6: 122,060,459 (GRCm39) Q1398H probably null Het
Mup8 T C 4: 60,220,403 (GRCm39) I110V probably benign Het
Nfkb1 A T 3: 135,309,522 (GRCm39) L12* probably null Het
Numa1 G A 7: 101,641,926 (GRCm39) probably null Het
Or52e18 T G 7: 104,609,870 (GRCm39) E23A probably damaging Het
Pbk C T 14: 66,054,094 (GRCm39) P213L probably damaging Het
Pdcd1lg2 T A 19: 29,431,905 (GRCm39) H224Q possibly damaging Het
Pkp1 C G 1: 135,805,406 (GRCm39) probably null Het
Rela A G 19: 5,689,967 (GRCm39) N139S probably damaging Het
Rgs3 G A 4: 62,542,143 (GRCm39) R39Q probably damaging Het
S1pr3 A G 13: 51,573,731 (GRCm39) E304G probably damaging Het
Sertad2 G A 11: 20,597,884 (GRCm39) G27S probably benign Het
Setmar T C 6: 108,053,387 (GRCm39) S294P possibly damaging Het
Smc2 A G 4: 52,459,024 (GRCm39) N473S probably benign Het
Ssr1 TCTCTTTC T 13: 38,169,972 (GRCm39) probably null Het
Tigd2 A G 6: 59,187,762 (GRCm39) I210V possibly damaging Het
Tmprss9 T A 10: 80,719,555 (GRCm39) F93L possibly damaging Het
U2surp T C 9: 95,361,360 (GRCm39) Y633C probably damaging Het
Usp18 A T 6: 121,239,781 (GRCm39) E292V possibly damaging Het
Utp18 T C 11: 93,776,449 (GRCm39) D12G probably benign Het
Vmn1r216 C A 13: 23,283,928 (GRCm39) H204N probably benign Het
Wdr97 T C 15: 76,241,372 (GRCm39) V626A probably damaging Het
Wwc1 A T 11: 35,761,809 (GRCm39) V619E probably null Het
Wwc1 T C 11: 35,780,100 (GRCm39) D285G probably damaging Het
Zfp3 A T 11: 70,662,590 (GRCm39) Q183L probably benign Het
Zfp955a A G 17: 33,460,660 (GRCm39) C491R probably damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84,885,252 (GRCm39) missense probably damaging 1.00
IGL00701:Usp32 APN 11 84,949,951 (GRCm39) splice site probably null
IGL00848:Usp32 APN 11 84,942,007 (GRCm39) splice site probably benign
IGL00934:Usp32 APN 11 84,897,902 (GRCm39) missense probably damaging 1.00
IGL01019:Usp32 APN 11 84,930,091 (GRCm39) missense probably damaging 0.97
IGL01302:Usp32 APN 11 84,879,308 (GRCm39) missense probably benign 0.05
IGL01444:Usp32 APN 11 84,949,990 (GRCm39) missense probably damaging 0.97
IGL01575:Usp32 APN 11 84,913,628 (GRCm39) missense probably damaging 1.00
IGL01981:Usp32 APN 11 84,927,350 (GRCm39) missense probably benign 0.02
IGL02118:Usp32 APN 11 84,923,003 (GRCm39) nonsense probably null
IGL02159:Usp32 APN 11 84,896,628 (GRCm39) splice site probably null
IGL02227:Usp32 APN 11 84,877,307 (GRCm39) missense probably damaging 1.00
IGL02363:Usp32 APN 11 84,935,613 (GRCm39) missense probably benign 0.01
IGL02524:Usp32 APN 11 84,900,837 (GRCm39) nonsense probably null
IGL02613:Usp32 APN 11 84,930,896 (GRCm39) missense probably damaging 0.99
IGL02720:Usp32 APN 11 84,897,817 (GRCm39) critical splice donor site probably null
IGL02738:Usp32 APN 11 84,974,632 (GRCm39) missense probably damaging 1.00
IGL02929:Usp32 APN 11 84,879,198 (GRCm39) missense probably benign 0.01
IGL03303:Usp32 APN 11 84,913,658 (GRCm39) missense probably damaging 1.00
BB010:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
BB020:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 84,900,900 (GRCm39) missense probably damaging 1.00
R0026:Usp32 UTSW 11 84,922,900 (GRCm39) missense possibly damaging 0.48
R0295:Usp32 UTSW 11 84,944,518 (GRCm39) missense probably damaging 0.98
R1320:Usp32 UTSW 11 84,908,619 (GRCm39) missense probably damaging 0.98
R1712:Usp32 UTSW 11 84,933,406 (GRCm39) missense probably benign 0.12
R1922:Usp32 UTSW 11 84,897,830 (GRCm39) nonsense probably null
R1973:Usp32 UTSW 11 84,994,757 (GRCm39) missense probably benign 0.09
R2010:Usp32 UTSW 11 84,930,830 (GRCm39) missense probably damaging 0.98
R2082:Usp32 UTSW 11 84,921,338 (GRCm39) missense probably damaging 0.99
R2355:Usp32 UTSW 11 84,896,735 (GRCm39) missense probably benign 0.34
R3147:Usp32 UTSW 11 84,919,913 (GRCm39) missense probably damaging 1.00
R3160:Usp32 UTSW 11 84,916,362 (GRCm39) missense probably damaging 0.97
R3162:Usp32 UTSW 11 84,916,362 (GRCm39) missense probably damaging 0.97
R3716:Usp32 UTSW 11 84,933,389 (GRCm39) missense probably damaging 1.00
R3816:Usp32 UTSW 11 84,885,210 (GRCm39) critical splice donor site probably null
R3870:Usp32 UTSW 11 84,897,881 (GRCm39) nonsense probably null
R3871:Usp32 UTSW 11 84,971,982 (GRCm39) missense probably null 0.81
R4041:Usp32 UTSW 11 84,908,565 (GRCm39) missense probably benign 0.40
R4079:Usp32 UTSW 11 84,930,055 (GRCm39) missense probably damaging 0.98
R4332:Usp32 UTSW 11 84,994,804 (GRCm39) missense possibly damaging 0.79
R4396:Usp32 UTSW 11 84,944,801 (GRCm39) missense probably benign
R4580:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably null
R4620:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably null
R4744:Usp32 UTSW 11 84,885,219 (GRCm39) missense probably damaging 1.00
R4909:Usp32 UTSW 11 84,946,598 (GRCm39) nonsense probably null
R5056:Usp32 UTSW 11 84,917,621 (GRCm39) missense probably benign 0.07
R5111:Usp32 UTSW 11 84,968,157 (GRCm39) missense possibly damaging 0.95
R5213:Usp32 UTSW 11 84,913,085 (GRCm39) missense probably damaging 1.00
R5308:Usp32 UTSW 11 84,908,544 (GRCm39) missense probably benign 0.12
R5381:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably benign
R5538:Usp32 UTSW 11 84,908,612 (GRCm39) missense possibly damaging 0.65
R5659:Usp32 UTSW 11 84,968,240 (GRCm39) missense possibly damaging 0.94
R6011:Usp32 UTSW 11 84,922,923 (GRCm39) missense possibly damaging 0.70
R6029:Usp32 UTSW 11 84,916,408 (GRCm39) missense probably damaging 0.99
R6074:Usp32 UTSW 11 84,885,399 (GRCm39) missense probably benign 0.00
R6331:Usp32 UTSW 11 84,877,402 (GRCm39) missense possibly damaging 0.92
R6353:Usp32 UTSW 11 84,913,107 (GRCm39) missense probably benign
R6714:Usp32 UTSW 11 84,917,696 (GRCm39) missense probably damaging 0.99
R6778:Usp32 UTSW 11 84,916,512 (GRCm39) missense probably benign 0.00
R6988:Usp32 UTSW 11 84,900,969 (GRCm39) missense probably benign 0.35
R6992:Usp32 UTSW 11 84,922,914 (GRCm39) missense probably damaging 0.99
R7182:Usp32 UTSW 11 84,930,996 (GRCm39) missense probably benign 0.34
R7186:Usp32 UTSW 11 84,942,060 (GRCm39) missense probably benign 0.45
R7198:Usp32 UTSW 11 84,913,681 (GRCm39) frame shift probably null
R7201:Usp32 UTSW 11 84,913,681 (GRCm39) frame shift probably null
R7469:Usp32 UTSW 11 84,879,379 (GRCm39) missense possibly damaging 0.94
R7502:Usp32 UTSW 11 84,913,724 (GRCm39) missense possibly damaging 0.48
R7513:Usp32 UTSW 11 84,917,938 (GRCm39) nonsense probably null
R7629:Usp32 UTSW 11 84,910,681 (GRCm39) frame shift probably null
R7703:Usp32 UTSW 11 84,968,153 (GRCm39) missense probably damaging 0.99
R7741:Usp32 UTSW 11 84,878,107 (GRCm39) missense probably damaging 0.99
R7765:Usp32 UTSW 11 84,885,234 (GRCm39) missense probably damaging 1.00
R7933:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
R7973:Usp32 UTSW 11 84,913,634 (GRCm39) missense probably damaging 0.99
R7989:Usp32 UTSW 11 84,925,126 (GRCm39) missense
R7998:Usp32 UTSW 11 84,885,252 (GRCm39) missense probably damaging 1.00
R8292:Usp32 UTSW 11 84,968,227 (GRCm39) missense probably damaging 0.99
R8305:Usp32 UTSW 11 84,923,011 (GRCm39) missense possibly damaging 0.83
R8548:Usp32 UTSW 11 84,908,653 (GRCm39) missense possibly damaging 0.52
R8924:Usp32 UTSW 11 84,916,370 (GRCm39) missense probably damaging 0.98
R9002:Usp32 UTSW 11 84,944,777 (GRCm39) missense probably damaging 0.96
R9145:Usp32 UTSW 11 84,913,118 (GRCm39) missense probably damaging 1.00
R9209:Usp32 UTSW 11 84,930,838 (GRCm39) missense probably damaging 0.98
R9211:Usp32 UTSW 11 84,913,559 (GRCm39) missense probably damaging 1.00
R9296:Usp32 UTSW 11 84,908,478 (GRCm39) missense probably damaging 1.00
R9310:Usp32 UTSW 11 84,942,028 (GRCm39) missense probably benign 0.29
R9417:Usp32 UTSW 11 84,885,369 (GRCm39) missense probably damaging 1.00
R9514:Usp32 UTSW 11 84,913,560 (GRCm39) missense probably damaging 0.99
R9652:Usp32 UTSW 11 84,921,317 (GRCm39) missense probably damaging 0.97
R9723:Usp32 UTSW 11 84,935,536 (GRCm39) nonsense probably null
R9757:Usp32 UTSW 11 84,968,155 (GRCm39) nonsense probably null
X0028:Usp32 UTSW 11 84,883,432 (GRCm39) missense probably benign 0.05
Z1177:Usp32 UTSW 11 84,879,438 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGGTGTGTATTATATCCCACCTG -3'
(R):5'- TCTTTGCCAGCATAAACCACTC -3'

Sequencing Primer
(F):5'- AGACACACCTCTTGAGTGTG -3'
(R):5'- TAAACCACTCACACCCCAGGG -3'
Posted On 2017-06-26