Incidental Mutation 'R6006:Usp32'
ID479493
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Nameubiquitin specific peptidase 32
Synonyms6430526O11Rik, 2900074J03Rik
MMRRC Submission 044183-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6006 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location84984442-85140161 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 84992451 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108075
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173156
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGGTGTGTATTATATCCCACCTG -3'
(R):5'- TCTTTGCCAGCATAAACCACTC -3'

Sequencing Primer
(F):5'- AGACACACCTCTTGAGTGTG -3'
(R):5'- TAAACCACTCACACCCCAGGG -3'
Posted On2017-06-26