Mutagenetix > Incidental Mutations

Incidental Mutation 'R6006:Usp32'

479493

Institutional Source

Beutler Lab

Gene Symbol

Usp32

Ensembl Gene

ENSMUSG00000000804

Gene Name

ubiquitin specific peptidase 32

Synonyms

6430526O11Rik, 2900074J03Rik

MMRRC Submission

044183-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6006 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84984442-85140161 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to C at 84992451 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108075]

Predicted Effect

probably benign
Transcript: ENSMUST00000000821

SMART Domains

Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
Pfam:UCH	32	260	4.1e-51	PFAM
Pfam:UCH_1	33	228	1.7e-7	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108075

SMART Domains

Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
EFh	232	260	4.66e0	SMART
EFh	268	296	5.8e-1	SMART
Blast:EFh	318	346	5e-7	BLAST
DUSP	389	588	2.32e-16	SMART
Pfam:Ubiquitin_3	628	711	2.4e-9	PFAM
Pfam:UCH	733	1564	2.4e-83	PFAM
Pfam:UCH_1	1202	1547	2.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173156

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.3%
20x: 91.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	A	G	8: 123,968,065	I296T	probably benign	Het
Abcb4	C	A	5: 8,946,026	T894K	probably damaging	Het
Acad12	C	T	5: 121,599,236	V491I	possibly damaging	Het
Actr8	T	A	14: 29,984,142		probably null	Het
Adam7	A	C	14: 68,511,396	D467E	probably damaging	Het
Adamts18	A	T	8: 113,706,974	C1043S	probably damaging	Het
Adgrb3	T	G	1: 25,826,531	D77A	possibly damaging	Het
Arhgap20	T	A	9: 51,850,126	D1056E	probably benign	Het
Bco1	A	G	8: 117,113,591		probably null	Het
Btn2a2	A	T	13: 23,486,363	W67R	probably damaging	Het
Camkmt	A	T	17: 85,452,238	N269Y	possibly damaging	Het
Cand1	A	G	10: 119,210,028	F991L	possibly damaging	Het
Cchcr1	A	G	17: 35,524,700	K234E	possibly damaging	Het
Cd14	T	C	18: 36,726,282	D40G	possibly damaging	Het
Cdc73	A	T	1: 143,617,439	F386I	probably damaging	Het
Cdk14	C	T	5: 5,249,211	M1I	probably null	Het
Cnpy3	A	C	17: 46,736,864	S220A	probably benign	Het
Col22a1	A	G	15: 71,973,836	V359A	probably damaging	Het
Col6a3	C	A	1: 90,768,383	C2654F	unknown	Het
Colgalt2	A	G	1: 152,473,161	T186A	probably damaging	Het
Cpsf4l	A	G	11: 113,699,927	V199A	probably benign	Het
Dhtkd1	G	A	2: 5,904,025	Q753*	probably null	Het
Ep400	A	G	5: 110,704,959	S1307P	unknown	Het
Fer1l6	T	C	15: 58,647,044	V1675A	probably damaging	Het
Glis1	T	C	4: 107,567,906	L238P	probably damaging	Het
Gm35339	T	C	15: 76,357,172	V626A	probably damaging	Het
Iqgap3	T	A	3: 88,091,547	D318E	probably damaging	Het
Lats1	T	C	10: 7,705,595	F715L	probably damaging	Het
Mlxip	T	C	5: 123,445,658	F428S	possibly damaging	Het
Morc3	T	G	16: 93,866,493	I528R	possibly damaging	Het
Mtx1	C	T	3: 89,210,306	G60D	probably damaging	Het
Mug2	G	C	6: 122,083,500	Q1398H	probably null	Het
Mup8	T	C	4: 60,220,403	I110V	probably benign	Het
Nfkb1	A	T	3: 135,603,761	L12*	probably null	Het
Numa1	G	A	7: 101,992,719		probably null	Het
Olfr670	T	G	7: 104,960,663	E23A	probably damaging	Het
Pbk	C	T	14: 65,816,645	P213L	probably damaging	Het
Pdcd1lg2	T	A	19: 29,454,505	H224Q	possibly damaging	Het
Pkp1	C	G	1: 135,877,668		probably null	Het
Rela	A	G	19: 5,639,939	N139S	probably damaging	Het
Rgs3	G	A	4: 62,623,906	R39Q	probably damaging	Het
S1pr3	A	G	13: 51,419,695	E304G	probably damaging	Het
Sertad2	G	A	11: 20,647,884	G27S	probably benign	Het
Setmar	T	C	6: 108,076,426	S294P	possibly damaging	Het
Smc2	A	G	4: 52,459,024	N473S	probably benign	Het
Ssr1	TCTCTTTC	T	13: 37,985,996		probably null	Het
Tigd2	A	G	6: 59,210,777	I210V	possibly damaging	Het
Tmprss9	T	A	10: 80,883,721	F93L	possibly damaging	Het
Ttc30a1	A	G	2: 75,981,488	Y84H	probably benign	Het
U2surp	T	C	9: 95,479,307	Y633C	probably damaging	Het
Usp18	A	T	6: 121,262,822	E292V	possibly damaging	Het
Utp18	T	C	11: 93,885,623	D12G	probably benign	Het
Vmn1r216	C	A	13: 23,099,758	H204N	probably benign	Het
Wwc1	A	T	11: 35,870,982	V619E	probably null	Het
Wwc1	T	C	11: 35,889,273	D285G	probably damaging	Het
Zfp3	A	T	11: 70,771,764	Q183L	probably benign	Het
Zfp955a	A	G	17: 33,241,686	C491R	probably damaging	Het

Other mutations in Usp32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Usp32	APN	11	84994426	missense	probably damaging	1.00
IGL00701:Usp32	APN	11	85059125	splice site	probably null
IGL00848:Usp32	APN	11	85051181	splice site	probably benign
IGL00934:Usp32	APN	11	85007076	missense	probably damaging	1.00
IGL01019:Usp32	APN	11	85039265	missense	probably damaging	0.97
IGL01302:Usp32	APN	11	84988482	missense	probably benign	0.05
IGL01444:Usp32	APN	11	85059164	missense	probably damaging	0.97
IGL01575:Usp32	APN	11	85022802	missense	probably damaging	1.00
IGL01981:Usp32	APN	11	85036524	missense	probably benign	0.02
IGL02118:Usp32	APN	11	85032177	nonsense	probably null
IGL02159:Usp32	APN	11	85005802	splice site	probably null
IGL02227:Usp32	APN	11	84986481	missense	probably damaging	1.00
IGL02363:Usp32	APN	11	85044787	missense	probably benign	0.01
IGL02524:Usp32	APN	11	85010011	nonsense	probably null
IGL02613:Usp32	APN	11	85040070	missense	probably damaging	0.99
IGL02720:Usp32	APN	11	85006991	critical splice donor site	probably null
IGL02738:Usp32	APN	11	85083806	missense	probably damaging	1.00
IGL02929:Usp32	APN	11	84988372	missense	probably benign	0.01
IGL03303:Usp32	APN	11	85022832	missense	probably damaging	1.00
PIT4812001:Usp32	UTSW	11	85010074	missense	probably damaging	1.00
R0026:Usp32	UTSW	11	85032074	missense	possibly damaging	0.48
R0295:Usp32	UTSW	11	85053692	missense	probably damaging	0.98
R1320:Usp32	UTSW	11	85017793	missense	probably damaging	0.98
R1712:Usp32	UTSW	11	85042580	missense	probably benign	0.12
R1922:Usp32	UTSW	11	85007004	nonsense	probably null
R1973:Usp32	UTSW	11	85103931	missense	probably benign	0.09
R2010:Usp32	UTSW	11	85040004	missense	probably damaging	0.98
R2082:Usp32	UTSW	11	85030512	missense	probably damaging	0.99
R2355:Usp32	UTSW	11	85005909	missense	probably benign	0.34
R3147:Usp32	UTSW	11	85029087	missense	probably damaging	1.00
R3160:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3162:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3716:Usp32	UTSW	11	85042563	missense	probably damaging	1.00
R3816:Usp32	UTSW	11	84994384	critical splice donor site	probably null
R3870:Usp32	UTSW	11	85007055	nonsense	probably null
R3871:Usp32	UTSW	11	85081156	missense	probably null	0.81
R4041:Usp32	UTSW	11	85017739	missense	probably benign	0.40
R4079:Usp32	UTSW	11	85039229	missense	probably damaging	0.98
R4332:Usp32	UTSW	11	85103978	missense	possibly damaging	0.79
R4396:Usp32	UTSW	11	85053975	missense	probably benign
R4580:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4620:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4744:Usp32	UTSW	11	84994393	missense	probably damaging	1.00
R4909:Usp32	UTSW	11	85055772	nonsense	probably null
R5056:Usp32	UTSW	11	85026795	missense	probably benign	0.07
R5111:Usp32	UTSW	11	85077331	missense	possibly damaging	0.95
R5213:Usp32	UTSW	11	85022259	missense	probably damaging	1.00
R5308:Usp32	UTSW	11	85017718	missense	probably benign	0.12
R5381:Usp32	UTSW	11	85059127	critical splice donor site	probably benign
R5538:Usp32	UTSW	11	85017786	missense	possibly damaging	0.65
R5659:Usp32	UTSW	11	85077414	missense	possibly damaging	0.94
R6011:Usp32	UTSW	11	85032097	missense	possibly damaging	0.70
R6029:Usp32	UTSW	11	85025582	missense	probably damaging	0.99
R6074:Usp32	UTSW	11	84994573	missense	probably benign	0.00
R6331:Usp32	UTSW	11	84986576	missense	possibly damaging	0.92
R6353:Usp32	UTSW	11	85022281	missense	probably benign
R6714:Usp32	UTSW	11	85026870	missense	probably damaging	0.99
R6778:Usp32	UTSW	11	85025686	missense	probably benign	0.00
R6988:Usp32	UTSW	11	85010143	missense	probably benign	0.35
R6992:Usp32	UTSW	11	85032088	missense	probably damaging	0.99
R7182:Usp32	UTSW	11	85040170	missense	probably benign	0.34
R7186:Usp32	UTSW	11	85051234	missense	probably benign	0.45
R7198:Usp32	UTSW	11	85022855	frame shift	probably null
R7201:Usp32	UTSW	11	85022855	frame shift	probably null
R7469:Usp32	UTSW	11	84988553	missense	possibly damaging	0.94
R7502:Usp32	UTSW	11	85022898	missense	possibly damaging	0.48
R7513:Usp32	UTSW	11	85027112	nonsense	probably null
R7629:Usp32	UTSW	11	85019855	frame shift	probably null
R7703:Usp32	UTSW	11	85077327	missense	probably damaging	0.99
R7741:Usp32	UTSW	11	84987281	missense	probably damaging	0.99
R7765:Usp32	UTSW	11	84994408	missense	probably damaging	1.00
R7998:Usp32	UTSW	11	84994426	missense	probably damaging	1.00
X0028:Usp32	UTSW	11	84992606	missense	probably benign	0.05
Z1177:Usp32	UTSW	11	84988612	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATAGGTGTGTATTATATCCCACCTG -3'
(R):5'- TCTTTGCCAGCATAAACCACTC -3'

Sequencing Primer
(F):5'- AGACACACCTCTTGAGTGTG -3'
(R):5'- TAAACCACTCACACCCCAGGG -3'

Posted On

2017-06-26