Incidental Mutation 'R6006:Ssr1'
ID479498
Institutional Source Beutler Lab
Gene Symbol Ssr1
Ensembl Gene ENSMUSG00000021427
Gene Namesignal sequence receptor, alpha
SynonymsTRAPalpha, SSR
MMRRC Submission 044183-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6006 (G1)
Quality Score217.468
Status Not validated
Chromosome13
Chromosomal Location37966605-37994217 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCTCTTTC to T at 37985996 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021864] [ENSMUST00000224399] [ENSMUST00000225246] [ENSMUST00000225319]
Predicted Effect probably null
Transcript: ENSMUST00000021864
SMART Domains Protein: ENSMUSP00000021864
Gene: ENSMUSG00000021427

DomainStartEndE-ValueType
Pfam:TRAP_alpha 6 285 1.1e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224399
Predicted Effect probably null
Transcript: ENSMUST00000225246
Predicted Effect probably null
Transcript: ENSMUST00000225319
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein encoded by this gene and a 22-kD glycoprotein. This gene generates several mRNA species as a result of complex alternative polyadenylation. This gene is unusual in that it utilizes arrays of polyA signal sequences that are mostly non-canonical. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality, subcutaneous edema, and cardiac defects, including absence of septation of the proximal part of the outflow tract, double outlet right ventricle, persistent truncus arteriosis, and abnormal development of the endocardial cushion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Ssr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Ssr1 APN 13 37983431 missense probably damaging 1.00
IGL02189:Ssr1 APN 13 37987516 critical splice donor site probably null
R1102:Ssr1 UTSW 13 37987615 missense probably benign 0.29
R1625:Ssr1 UTSW 13 37989503 critical splice donor site probably null
R2022:Ssr1 UTSW 13 37989549 missense probably damaging 0.96
R2055:Ssr1 UTSW 13 37987785 splice site probably benign
R4274:Ssr1 UTSW 13 37985290 missense possibly damaging 0.78
R6659:Ssr1 UTSW 13 37987690 missense probably damaging 0.98
R6920:Ssr1 UTSW 13 37986022 missense probably damaging 1.00
R7034:Ssr1 UTSW 13 37994025 missense probably null
R7036:Ssr1 UTSW 13 37994025 missense probably null
Predicted Primers PCR Primer
(F):5'- CTTTGTAGAAGCAGTGCTCAGG -3'
(R):5'- CGGAGAATTAGACCAGGCATTG -3'

Sequencing Primer
(F):5'- AAGCAGTGCTCAGGCTCCAC -3'
(R):5'- CAGGCATTGAATAGTACAATTATGGC -3'
Posted On2017-06-26