Incidental Mutation 'R6006:Pbk'
ID479501
Institutional Source Beutler Lab
Gene Symbol Pbk
Ensembl Gene ENSMUSG00000022033
Gene NamePDZ binding kinase
Synonyms2810434B10Rik, TOPK, D14Ertd732e
MMRRC Submission 044183-MU
Accession Numbers

Genbank: NM_023209; MGI: 1289156

Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R6006 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location65805837-65817822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65816645 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 213 (P213L)
Ref Sequence ENSEMBL: ENSMUSP00000022612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022612] [ENSMUST00000022613] [ENSMUST00000139644]
Predicted Effect probably damaging
Transcript: ENSMUST00000022612
AA Change: P213L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022612
Gene: ENSMUSG00000022033
AA Change: P213L

DomainStartEndE-ValueType
Pfam:Pkinase 32 317 1.7e-40 PFAM
Pfam:Pkinase_Tyr 32 317 2.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022613
SMART Domains Protein: ENSMUSP00000022613
Gene: ENSMUSG00000022034

DomainStartEndE-ValueType
low complexity region 139 156 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:zf-C2H2_3 371 410 1.6e-18 PFAM
Pfam:Acetyltransf_13 520 588 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139644
SMART Domains Protein: ENSMUSP00000114484
Gene: ENSMUSG00000022033

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 119 3.5e-5 PFAM
Pfam:Pkinase 32 120 7.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152130
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase related to the dual specific mitogen-activated protein kinase kinase (MAPKK) family. Evidence suggests that mitotic phosphorylation is required for its catalytic activity. The encoded protein may be involved in the activation of lymphoid cells and support testicular functions, with a suggested role in the process of spermatogenesis. Overexpression of this gene has been implicated in tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased UV-induced loss of the horny layer, epidermis thickening, skin fibrosis, and deposition of extracellular matrix in the skin. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Pbk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pbk APN 14 65813891 missense probably damaging 1.00
IGL00858:Pbk APN 14 65811924 splice site probably benign
IGL01472:Pbk APN 14 65816710 missense probably benign 0.06
IGL03239:Pbk APN 14 65817218 missense probably benign 0.22
A5278:Pbk UTSW 14 65813939 missense probably damaging 1.00
R0067:Pbk UTSW 14 65815226 missense possibly damaging 0.90
R0645:Pbk UTSW 14 65813796 splice site probably benign
R4696:Pbk UTSW 14 65811937 missense probably benign 0.00
R4834:Pbk UTSW 14 65815284 nonsense probably null
R4856:Pbk UTSW 14 65815201 missense probably damaging 1.00
R4886:Pbk UTSW 14 65815201 missense probably damaging 1.00
R6086:Pbk UTSW 14 65815253 nonsense probably null
R7272:Pbk UTSW 14 65815172 missense probably damaging 1.00
Z1088:Pbk UTSW 14 65813948 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAAGTTGTGAGCATAGATG -3'
(R):5'- CAATGTCGATCTCATTTATATGGGG -3'

Sequencing Primer
(F):5'- CCAAGTTGTGAGCATAGATGAAAATG -3'
(R):5'- GGGGTTAAATCTAGCCAATTAATCAC -3'
Posted On2017-06-26