Incidental Mutation 'R6006:Fer1l6'
ID479503
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Namefer-1-like 6 (C. elegans)
SynonymsEG631797
MMRRC Submission 044183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6006 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location58510048-58665092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58647044 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1675 (V1675A)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159705
Predicted Effect probably damaging
Transcript: ENSMUST00000161028
AA Change: V1675A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: V1675A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col22a1 A G 15: 71,973,836 V359A probably damaging Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 unclassified probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 intron probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATCTAACCTGCCGCTGTG -3'
(R):5'- CTCCCAAAGCTAGGGTGATATC -3'

Sequencing Primer
(F):5'- AATGAAGCTGGTTGAGTCACTC -3'
(R):5'- CCAAAGCTAGGGTGATATCCTTAAC -3'
Posted On2017-06-26