Incidental Mutation 'R6006:Col22a1'
ID479504
Institutional Source Beutler Lab
Gene Symbol Col22a1
Ensembl Gene ENSMUSG00000079022
Gene Namecollagen, type XXII, alpha 1
SynonymsC80743, 2310067L16Rik
MMRRC Submission 044183-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6006 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location71795795-72034227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71973836 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 359 (V359A)
Ref Sequence ENSEMBL: ENSMUSP00000125069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159993]
Predicted Effect probably damaging
Transcript: ENSMUST00000159993
AA Change: V359A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: V359A

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
VWA 45 227 1.35e-51 SMART
TSPN 248 436 1.26e-33 SMART
low complexity region 454 470 N/A INTRINSIC
internal_repeat_3 494 555 1.96e-13 PROSPERO
internal_repeat_1 496 643 1.49e-19 PROSPERO
low complexity region 644 657 N/A INTRINSIC
low complexity region 673 707 N/A INTRINSIC
Pfam:Collagen 751 823 1.5e-9 PFAM
Pfam:Collagen 810 863 2.3e-10 PFAM
Pfam:Collagen 869 931 4.8e-11 PFAM
Pfam:Collagen 926 990 1.1e-10 PFAM
Pfam:Collagen 1031 1087 1.7e-10 PFAM
Pfam:Collagen 1104 1162 1.8e-11 PFAM
low complexity region 1173 1227 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
internal_repeat_2 1257 1348 3.25e-18 PROSPERO
internal_repeat_4 1268 1347 9.67e-7 PROSPERO
Pfam:Collagen 1389 1448 4e-10 PFAM
Pfam:Collagen 1481 1540 2.6e-9 PFAM
low complexity region 1546 1558 N/A INTRINSIC
low complexity region 1580 1590 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,065 I296T probably benign Het
Abcb4 C A 5: 8,946,026 T894K probably damaging Het
Acad12 C T 5: 121,599,236 V491I possibly damaging Het
Actr8 T A 14: 29,984,142 probably null Het
Adam7 A C 14: 68,511,396 D467E probably damaging Het
Adamts18 A T 8: 113,706,974 C1043S probably damaging Het
Adgrb3 T G 1: 25,826,531 D77A possibly damaging Het
Arhgap20 T A 9: 51,850,126 D1056E probably benign Het
Bco1 A G 8: 117,113,591 probably null Het
Btn2a2 A T 13: 23,486,363 W67R probably damaging Het
Camkmt A T 17: 85,452,238 N269Y possibly damaging Het
Cand1 A G 10: 119,210,028 F991L possibly damaging Het
Cchcr1 A G 17: 35,524,700 K234E possibly damaging Het
Cd14 T C 18: 36,726,282 D40G possibly damaging Het
Cdc73 A T 1: 143,617,439 F386I probably damaging Het
Cdk14 C T 5: 5,249,211 M1I probably null Het
Cnpy3 A C 17: 46,736,864 S220A probably benign Het
Col6a3 C A 1: 90,768,383 C2654F unknown Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cpsf4l A G 11: 113,699,927 V199A probably benign Het
Dhtkd1 G A 2: 5,904,025 Q753* probably null Het
Ep400 A G 5: 110,704,959 S1307P unknown Het
Fer1l6 T C 15: 58,647,044 V1675A probably damaging Het
Glis1 T C 4: 107,567,906 L238P probably damaging Het
Gm35339 T C 15: 76,357,172 V626A probably damaging Het
Iqgap3 T A 3: 88,091,547 D318E probably damaging Het
Lats1 T C 10: 7,705,595 F715L probably damaging Het
Mlxip T C 5: 123,445,658 F428S possibly damaging Het
Morc3 T G 16: 93,866,493 I528R possibly damaging Het
Mtx1 C T 3: 89,210,306 G60D probably damaging Het
Mug2 G C 6: 122,083,500 Q1398H probably null Het
Mup8 T C 4: 60,220,403 I110V probably benign Het
Nfkb1 A T 3: 135,603,761 L12* probably null Het
Numa1 G A 7: 101,992,719 probably null Het
Olfr670 T G 7: 104,960,663 E23A probably damaging Het
Pbk C T 14: 65,816,645 P213L probably damaging Het
Pdcd1lg2 T A 19: 29,454,505 H224Q possibly damaging Het
Pkp1 C G 1: 135,877,668 probably null Het
Rela A G 19: 5,639,939 N139S probably damaging Het
Rgs3 G A 4: 62,623,906 R39Q probably damaging Het
S1pr3 A G 13: 51,419,695 E304G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Setmar T C 6: 108,076,426 S294P possibly damaging Het
Smc2 A G 4: 52,459,024 N473S probably benign Het
Ssr1 TCTCTTTC T 13: 37,985,996 probably null Het
Tigd2 A G 6: 59,210,777 I210V possibly damaging Het
Tmprss9 T A 10: 80,883,721 F93L possibly damaging Het
Ttc30a1 A G 2: 75,981,488 Y84H probably benign Het
U2surp T C 9: 95,479,307 Y633C probably damaging Het
Usp18 A T 6: 121,262,822 E292V possibly damaging Het
Usp32 A C 11: 84,992,451 probably null Het
Utp18 T C 11: 93,885,623 D12G probably benign Het
Vmn1r216 C A 13: 23,099,758 H204N probably benign Het
Wwc1 A T 11: 35,870,982 V619E probably null Het
Wwc1 T C 11: 35,889,273 D285G probably damaging Het
Zfp3 A T 11: 70,771,764 Q183L probably benign Het
Zfp955a A G 17: 33,241,686 C491R probably damaging Het
Other mutations in Col22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Col22a1 APN 15 71860958 critical splice donor site probably null
IGL00434:Col22a1 APN 15 72006675 missense possibly damaging 0.71
IGL00721:Col22a1 APN 15 71846177 missense unknown
IGL00902:Col22a1 APN 15 71964659 missense probably damaging 1.00
IGL01311:Col22a1 APN 15 71973637 splice site probably benign
IGL01329:Col22a1 APN 15 71907040 missense probably benign 0.02
IGL01527:Col22a1 APN 15 71907031 missense probably damaging 0.98
IGL01870:Col22a1 APN 15 71952528 missense probably benign 0.07
IGL02002:Col22a1 APN 15 71811097 splice site probably benign
IGL02248:Col22a1 APN 15 71799448 missense unknown
IGL02322:Col22a1 APN 15 71822653 missense unknown
IGL02472:Col22a1 APN 15 71827753 splice site probably benign
IGL02685:Col22a1 APN 15 71801915 missense unknown
IGL02888:Col22a1 APN 15 71846219 missense unknown
IGL02971:Col22a1 APN 15 72006738 missense probably damaging 1.00
IGL03175:Col22a1 APN 15 71969103 missense possibly damaging 0.81
IGL03240:Col22a1 APN 15 71807928 missense unknown
R0083:Col22a1 UTSW 15 71890497 missense possibly damaging 0.70
R0383:Col22a1 UTSW 15 71869004 missense unknown
R0449:Col22a1 UTSW 15 71962671 critical splice donor site probably null
R0508:Col22a1 UTSW 15 71933413 missense unknown
R0944:Col22a1 UTSW 15 71881662 missense probably benign 0.03
R1289:Col22a1 UTSW 15 71837377 missense unknown
R1436:Col22a1 UTSW 15 71922957 splice site probably benign
R1439:Col22a1 UTSW 15 71952377 splice site probably benign
R1460:Col22a1 UTSW 15 71821931 missense unknown
R1680:Col22a1 UTSW 15 71799361 missense unknown
R1715:Col22a1 UTSW 15 72006981 missense possibly damaging 0.79
R1742:Col22a1 UTSW 15 71801913 missense unknown
R1745:Col22a1 UTSW 15 72006787 missense probably damaging 1.00
R1763:Col22a1 UTSW 15 72007176 missense probably damaging 0.96
R1932:Col22a1 UTSW 15 71870140 missense unknown
R2125:Col22a1 UTSW 15 71848577 missense unknown
R2126:Col22a1 UTSW 15 71857253 nonsense probably null
R2137:Col22a1 UTSW 15 72006948 missense possibly damaging 0.46
R2860:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2861:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2862:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R3704:Col22a1 UTSW 15 71970307 missense probably damaging 1.00
R3778:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
R3940:Col22a1 UTSW 15 71981933 nonsense probably null
R3950:Col22a1 UTSW 15 71977358 missense possibly damaging 0.90
R4240:Col22a1 UTSW 15 72007131 missense probably damaging 1.00
R4531:Col22a1 UTSW 15 72007149 missense probably damaging 1.00
R4597:Col22a1 UTSW 15 71964662 missense possibly damaging 0.83
R4604:Col22a1 UTSW 15 71952339 missense probably benign 0.36
R4654:Col22a1 UTSW 15 71973695 missense possibly damaging 0.95
R4782:Col22a1 UTSW 15 71801925 missense unknown
R4847:Col22a1 UTSW 15 71799499 missense unknown
R4980:Col22a1 UTSW 15 71801943 missense unknown
R4981:Col22a1 UTSW 15 71861066 missense unknown
R4996:Col22a1 UTSW 15 72007161 missense probably damaging 0.99
R5007:Col22a1 UTSW 15 71944422 missense probably damaging 1.00
R5135:Col22a1 UTSW 15 71799337 missense unknown
R5197:Col22a1 UTSW 15 72009406 missense probably damaging 0.96
R5292:Col22a1 UTSW 15 71970336 missense probably damaging 1.00
R5449:Col22a1 UTSW 15 71821949 missense unknown
R5480:Col22a1 UTSW 15 71964611 missense probably damaging 0.98
R5627:Col22a1 UTSW 15 71981918 missense probably damaging 0.98
R5828:Col22a1 UTSW 15 72009491 missense probably benign 0.01
R5927:Col22a1 UTSW 15 72006966 missense probably damaging 1.00
R6245:Col22a1 UTSW 15 71973816 missense probably damaging 0.99
R6288:Col22a1 UTSW 15 71894869 critical splice acceptor site probably null
R6482:Col22a1 UTSW 15 71890489 missense possibly damaging 0.93
R6497:Col22a1 UTSW 15 71890576 missense possibly damaging 0.85
R6579:Col22a1 UTSW 15 71881653 missense probably benign 0.18
R6643:Col22a1 UTSW 15 71822037 intron probably null
R6663:Col22a1 UTSW 15 71820059 missense unknown
R7179:Col22a1 UTSW 15 71933413 missense unknown
R7215:Col22a1 UTSW 15 71970332 nonsense probably null
R7216:Col22a1 UTSW 15 71973845 missense probably damaging 1.00
R7505:Col22a1 UTSW 15 71799399 nonsense probably null
R7585:Col22a1 UTSW 15 71892205 missense probably damaging 0.99
R7788:Col22a1 UTSW 15 71952317 critical splice donor site probably null
X0066:Col22a1 UTSW 15 71801879 missense unknown
X0066:Col22a1 UTSW 15 71846200 missense unknown
Y5406:Col22a1 UTSW 15 71799515 missense unknown
Z1177:Col22a1 UTSW 15 71915120 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGGTACTCACATCAATGGGAAC -3'
(R):5'- ATAGGGCTCAGGACTGACTC -3'

Sequencing Primer
(F):5'- GTCATAGAGACGTTTGCCAATCACAG -3'
(R):5'- TCAGGACTGACTCTGCCC -3'
Posted On2017-06-26