Mutagenetix > Incidental Mutation

Incidental Mutation 'R6007:Vil1'

479517

Institutional Source

Beutler Lab

Gene Symbol

Vil1

Ensembl Gene

ENSMUSG00000026175

Gene Name

villin 1

Synonyms

MMRRC Submission

044184-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R6007 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74409376-74435559 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74419867 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 177 (W177R)

Ref Sequence

ENSEMBL: ENSMUSP00000027366 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027366]

AlphaFold

Q62468

Predicted Effect

probably damaging
Transcript: ENSMUST00000027366
AA Change: W177R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027366
Gene: ENSMUSG00000026175
AA Change: W177R

Domain	Start	End	E-Value	Type
GEL	17	114	2.93e-29	SMART
GEL	135	229	1.33e-18	SMART
GEL	251	349	5.85e-29	SMART
GEL	398	495	1.44e-28	SMART
GEL	515	601	7.31e-30	SMART
GEL	620	714	1.36e-29	SMART
VHP	792	827	1.77e-14	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000159749
AA Change: W78R

SMART Domains

Protein: ENSMUSP00000123786
Gene: ENSMUSG00000026175
AA Change: W78R

Domain	Start	End	E-Value	Type
GEL	37	131	1.33e-18	SMART
GEL	153	248	6.68e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161087

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163018

Meta Mutation Damage Score

0.9583

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.1%
20x: 90.6%

Validation Efficiency

100% (54/54)

MGI Phenotype

Strain: 1859841
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of calcium-regulated actin-binding proteins. This protein represents a dominant part of the brush border cytoskeleton which functions in the capping, severing, and bundling of actin filaments. Two mRNAs of 2.7 kb and 3.5 kb have been observed; they result from utilization of alternate poly-adenylation signals present in the terminal exon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not exhibit gross abnormalities or apparent defects of microvilli morphogenesis, however in one line, an increased sensitivity to colitis induced by dextran sulfate was observed. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	G	T	6: 83,160,918	A9S	possibly damaging	Het
4930407I10Rik	C	G	15: 82,062,739	T279S	probably benign	Het
A830018L16Rik	A	G	1: 11,511,916		probably null	Het
Abcg5	T	G	17: 84,668,964	I482L	probably benign	Het
Adgrf5	T	A	17: 43,437,571	D44E	probably damaging	Het
Amh	A	G	10: 80,805,471	N75S	probably benign	Het
Arl8a	T	C	1: 135,152,868		probably null	Het
Bpifb4	T	C	2: 153,942,560	Y63H	possibly damaging	Het
Chd5	A	T	4: 152,379,421	E1449V	probably null	Het
Chml	A	G	1: 175,688,028	V109A	probably benign	Het
Crybg3	G	T	16: 59,554,474	S2139*	probably null	Het
Cyp2c68	T	C	19: 39,734,336	D256G	probably damaging	Het
Dchs2	G	T	3: 83,346,227	V2315L	probably damaging	Het
Ddx20	T	C	3: 105,683,420	I227V	possibly damaging	Het
Drg2	T	C	11: 60,462,625	V266A	possibly damaging	Het
Flcn	C	A	11: 59,792,622	E576D	probably benign	Het
Fstl5	T	A	3: 76,410,592	D188E	probably damaging	Het
Gm14496	A	G	2: 181,997,530	Q471R	probably benign	Het
Gm43772	T	C	5: 66,174,991		probably benign	Het
Gpc6	C	T	14: 117,951,261	H436Y	probably damaging	Het
Gpr179	A	T	11: 97,335,802	C1842*	probably null	Het
Ints8	G	A	4: 11,208,845	T934I	possibly damaging	Het
Iqsec1	G	T	6: 90,660,987	C1050*	probably null	Het
Larp4b	T	C	13: 9,168,757	V510A	probably benign	Het
Map3k13	A	T	16: 21,905,183	D305V	possibly damaging	Het
Mc5r	A	T	18: 68,339,247	I226F	possibly damaging	Het
Mme	G	A	3: 63,343,508	W323*	probably null	Het
Mrpl24	A	G	3: 87,922,398	Y97C	probably benign	Het
Mslnl	G	A	17: 25,746,775	S541N	probably benign	Het
Npepl1	T	C	2: 174,121,057	V412A	probably benign	Het
Nrg3	T	A	14: 39,472,452	K117*	probably null	Het
Olfr1275	T	C	2: 111,230,930	T288A	probably benign	Het
Olfr736	G	T	14: 50,393,491	C245F	probably damaging	Het
Orc2	A	T	1: 58,467,692	M447K	probably benign	Het
Phf3	A	T	1: 30,804,345	H1844Q	probably damaging	Het
Plxnc1	T	C	10: 94,793,290	I1541V	possibly damaging	Het
Rapgef4	T	C	2: 72,179,949	Y284H	possibly damaging	Het
Rnf180	C	A	13: 105,181,449		probably null	Het
Secisbp2	T	C	13: 51,665,359	I325T	probably damaging	Het
Sertad2	G	A	11: 20,647,884	G27S	probably benign	Het
Slc4a10	A	G	2: 62,268,872	M625V	probably benign	Het
Synpo	T	A	18: 60,603,615	M420L	probably benign	Het
Tmem116	A	C	5: 121,517,892	*147C	probably null	Het
Top2b	G	A	14: 16,423,779		probably null	Het
Trp53bp2	T	A	1: 182,455,740	C1014S	probably damaging	Het
Unc5b	A	G	10: 60,765,360	F896L	probably damaging	Het
Vmn2r107	A	T	17: 20,375,054	Y623F	probably benign	Het
Vmn2r86	T	C	10: 130,453,666	Y120C	probably damaging	Het
Wdr18	A	G	10: 79,965,343	T197A	possibly damaging	Het
Ylpm1	A	G	12: 85,029,290	M472V	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp677	A	G	17: 21,397,656	Y325C	probably damaging	Het
Zfyve1	A	G	12: 83,558,704	F407S	probably damaging	Het

Other mutations in Vil1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Vil1	APN	1	74423875	missense	probably damaging	1.00
IGL00703:Vil1	APN	1	74423960	missense	possibly damaging	0.61
IGL01011:Vil1	APN	1	74434887	splice site	probably null
IGL01314:Vil1	APN	1	74428238	missense	probably damaging	1.00
IGL01772:Vil1	APN	1	74415119	missense	probably benign
IGL02378:Vil1	APN	1	74430691	splice site	probably null
IGL02517:Vil1	APN	1	74426692	missense	probably benign	0.43
IGL02955:Vil1	APN	1	74418523	missense	probably benign	0.10
IGL03036:Vil1	APN	1	74419612	missense	probably damaging	1.00
PIT4362001:Vil1	UTSW	1	74421383	missense	probably damaging	1.00
R0104:Vil1	UTSW	1	74418366	missense	probably benign	0.44
R0241:Vil1	UTSW	1	74426694	missense	probably damaging	1.00
R0241:Vil1	UTSW	1	74426694	missense	probably damaging	1.00
R0496:Vil1	UTSW	1	74421340	missense	possibly damaging	0.88
R1329:Vil1	UTSW	1	74427558	missense	probably benign	0.00
R1824:Vil1	UTSW	1	74418447	missense	probably benign	0.00
R1916:Vil1	UTSW	1	74418525	missense	probably benign
R2188:Vil1	UTSW	1	74427565	missense	probably benign	0.22
R2216:Vil1	UTSW	1	74425679	missense	probably benign	0.05
R3808:Vil1	UTSW	1	74427613	missense	probably benign
R3939:Vil1	UTSW	1	74432415	missense	probably benign	0.09
R4288:Vil1	UTSW	1	74418525	missense	probably benign
R4648:Vil1	UTSW	1	74432298	missense	probably benign
R4748:Vil1	UTSW	1	74421266	missense	probably damaging	1.00
R5333:Vil1	UTSW	1	74432390	missense	probably benign
R5429:Vil1	UTSW	1	74432331	missense	probably benign	0.05
R5973:Vil1	UTSW	1	74416033	missense	possibly damaging	0.93
R6247:Vil1	UTSW	1	74432339	missense	probably benign
R6306:Vil1	UTSW	1	74421311	missense	possibly damaging	0.90
R6989:Vil1	UTSW	1	74423954	missense	probably damaging	0.99
R7112:Vil1	UTSW	1	74416002	missense	probably damaging	1.00
R7320:Vil1	UTSW	1	74418444	missense	probably damaging	1.00
R7481:Vil1	UTSW	1	74419899	missense	probably damaging	1.00
R7553:Vil1	UTSW	1	74426732	critical splice donor site	probably null
R7709:Vil1	UTSW	1	74426595	missense	probably benign	0.39
R7791:Vil1	UTSW	1	74428136	missense	probably damaging	1.00
R8159:Vil1	UTSW	1	74423977	missense	probably benign	0.00
R8190:Vil1	UTSW	1	74434893	nonsense	probably null
R9650:Vil1	UTSW	1	74425616	missense	probably benign	0.32
R9679:Vil1	UTSW	1	74430674	missense	probably benign	0.00
R9734:Vil1	UTSW	1	74415150	missense	possibly damaging	0.46
Z1176:Vil1	UTSW	1	74428232	missense	probably damaging	0.98
Z1177:Vil1	UTSW	1	74415132	missense	probably damaging	1.00
Z1177:Vil1	UTSW	1	74421430	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAAGAGGAATGTGCTGGCTG -3'
(R):5'- CACAAGCAGTATGCCTCTTCATG -3'

Sequencing Primer
(F):5'- AATGTGCTGGCTGGAGAGG -3'
(R):5'- GCAGTATGCCTCTTCATGTACATAG -3'

Posted On

2017-06-26