Mutagenetix > Incidental Mutation

Incidental Mutation 'R6007:Npepl1'

479525

Institutional Source

Beutler Lab

Gene Symbol

Npepl1

Ensembl Gene

ENSMUSG00000039263

Gene Name

aminopeptidase-like 1

Synonyms

MMRRC Submission

044184-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R6007 (G1)

Quality Score

224.009

Status

Validated

Chromosome

Chromosomal Location

174110349-174123070 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 174121057 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 412 (V412A)

Ref Sequence

ENSEMBL: ENSMUSP00000042808 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044415]

AlphaFold

Q6NSR8

Predicted Effect

probably benign
Transcript: ENSMUST00000044415
AA Change: V412A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000042808
Gene: ENSMUSG00000039263
AA Change: V412A

Domain	Start	End	E-Value	Type
low complexity region	22	32	N/A	INTRINSIC
Pfam:Peptidase_M17	179	484	1.9e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125502

SMART Domains

Protein: ENSMUSP00000133202
Gene: ENSMUSG00000039263

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M17	104	207	4.4e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131346

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136449

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153957

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166709

Meta Mutation Damage Score

0.1054

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.1%
20x: 90.6%

Validation Efficiency

100% (54/54)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	G	T	6: 83,160,918	A9S	possibly damaging	Het
4930407I10Rik	C	G	15: 82,062,739	T279S	probably benign	Het
A830018L16Rik	A	G	1: 11,511,916		probably null	Het
Abcg5	T	G	17: 84,668,964	I482L	probably benign	Het
Adgrf5	T	A	17: 43,437,571	D44E	probably damaging	Het
Amh	A	G	10: 80,805,471	N75S	probably benign	Het
Arl8a	T	C	1: 135,152,868		probably null	Het
Bpifb4	T	C	2: 153,942,560	Y63H	possibly damaging	Het
Chd5	A	T	4: 152,379,421	E1449V	probably null	Het
Chml	A	G	1: 175,688,028	V109A	probably benign	Het
Crybg3	G	T	16: 59,554,474	S2139*	probably null	Het
Cyp2c68	T	C	19: 39,734,336	D256G	probably damaging	Het
Dchs2	G	T	3: 83,346,227	V2315L	probably damaging	Het
Ddx20	T	C	3: 105,683,420	I227V	possibly damaging	Het
Drg2	T	C	11: 60,462,625	V266A	possibly damaging	Het
Flcn	C	A	11: 59,792,622	E576D	probably benign	Het
Fstl5	T	A	3: 76,410,592	D188E	probably damaging	Het
Gm14496	A	G	2: 181,997,530	Q471R	probably benign	Het
Gm43772	T	C	5: 66,174,991		probably benign	Het
Gpc6	C	T	14: 117,951,261	H436Y	probably damaging	Het
Gpr179	A	T	11: 97,335,802	C1842*	probably null	Het
Ints8	G	A	4: 11,208,845	T934I	possibly damaging	Het
Iqsec1	G	T	6: 90,660,987	C1050*	probably null	Het
Larp4b	T	C	13: 9,168,757	V510A	probably benign	Het
Map3k13	A	T	16: 21,905,183	D305V	possibly damaging	Het
Mc5r	A	T	18: 68,339,247	I226F	possibly damaging	Het
Mme	G	A	3: 63,343,508	W323*	probably null	Het
Mrpl24	A	G	3: 87,922,398	Y97C	probably benign	Het
Mslnl	G	A	17: 25,746,775	S541N	probably benign	Het
Nrg3	T	A	14: 39,472,452	K117*	probably null	Het
Olfr1275	T	C	2: 111,230,930	T288A	probably benign	Het
Olfr736	G	T	14: 50,393,491	C245F	probably damaging	Het
Orc2	A	T	1: 58,467,692	M447K	probably benign	Het
Phf3	A	T	1: 30,804,345	H1844Q	probably damaging	Het
Plxnc1	T	C	10: 94,793,290	I1541V	possibly damaging	Het
Rapgef4	T	C	2: 72,179,949	Y284H	possibly damaging	Het
Rnf180	C	A	13: 105,181,449		probably null	Het
Secisbp2	T	C	13: 51,665,359	I325T	probably damaging	Het
Sertad2	G	A	11: 20,647,884	G27S	probably benign	Het
Slc4a10	A	G	2: 62,268,872	M625V	probably benign	Het
Synpo	T	A	18: 60,603,615	M420L	probably benign	Het
Tmem116	A	C	5: 121,517,892	*147C	probably null	Het
Top2b	G	A	14: 16,423,779		probably null	Het
Trp53bp2	T	A	1: 182,455,740	C1014S	probably damaging	Het
Unc5b	A	G	10: 60,765,360	F896L	probably damaging	Het
Vil1	T	C	1: 74,419,867	W177R	probably damaging	Het
Vmn2r107	A	T	17: 20,375,054	Y623F	probably benign	Het
Vmn2r86	T	C	10: 130,453,666	Y120C	probably damaging	Het
Wdr18	A	G	10: 79,965,343	T197A	possibly damaging	Het
Ylpm1	A	G	12: 85,029,290	M472V	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp677	A	G	17: 21,397,656	Y325C	probably damaging	Het
Zfyve1	A	G	12: 83,558,704	F407S	probably damaging	Het

Other mutations in Npepl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Npepl1	APN	2	174120548	missense	probably damaging	1.00
IGL01651:Npepl1	APN	2	174114388	splice site	probably benign
IGL01998:Npepl1	APN	2	174116200	splice site	probably benign
IGL02079:Npepl1	APN	2	174119390	intron	probably benign
R0081:Npepl1	UTSW	2	174116086	missense	probably damaging	1.00
R1236:Npepl1	UTSW	2	174114480	critical splice donor site	probably null
R2350:Npepl1	UTSW	2	174111773	missense	probably benign
R3780:Npepl1	UTSW	2	174120654	missense	probably damaging	1.00
R3950:Npepl1	UTSW	2	174121113	missense	probably damaging	1.00
R4688:Npepl1	UTSW	2	174114442	missense	possibly damaging	0.78
R5650:Npepl1	UTSW	2	174121536	missense	possibly damaging	0.83
R5916:Npepl1	UTSW	2	174121544	missense	probably benign	0.01
R6487:Npepl1	UTSW	2	174111732	missense	probably benign	0.16
R7267:Npepl1	UTSW	2	174122116	missense	probably damaging	1.00
R7881:Npepl1	UTSW	2	174120594	missense	probably damaging	1.00
R8103:Npepl1	UTSW	2	174111209	missense	probably benign	0.00
R9547:Npepl1	UTSW	2	174120237	missense	probably null	0.88
R9740:Npepl1	UTSW	2	174121490	missense	probably damaging	0.99
Z1177:Npepl1	UTSW	2	174122130	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AACATGTGCCGCTGTCATTC -3'
(R):5'- TGAGCATGCTCAGTGACGTC -3'

Sequencing Primer
(F):5'- TTGGACCGGAACCCATGC -3'
(R):5'- TCAGTGACGTCGGACTCTGTAC -3'

Posted On

2017-06-26