Incidental Mutation 'R6007:Fstl5'
ID479528
Institutional Source Beutler Lab
Gene Symbol Fstl5
Ensembl Gene ENSMUSG00000034098
Gene Namefollistatin-like 5
Synonyms9130207J01Rik
MMRRC Submission 044184-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6007 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location76074270-76710019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76410592 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 188 (D188E)
Ref Sequence ENSEMBL: ENSMUSP00000125393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038364] [ENSMUST00000160261]
Predicted Effect probably damaging
Transcript: ENSMUST00000038364
AA Change: D188E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038506
Gene: ENSMUSG00000034098
AA Change: D188E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
KAZAL 88 133 2.16e-9 SMART
IGc2 261 328 1.11e-5 SMART
IGc2 353 420 3.85e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159686
Predicted Effect probably damaging
Transcript: ENSMUST00000160261
AA Change: D188E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125393
Gene: ENSMUSG00000034098
AA Change: D188E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
KAZAL 88 133 2.16e-9 SMART
IGc2 261 328 1.11e-5 SMART
IGc2 353 420 3.85e-14 SMART
Meta Mutation Damage Score 0.5536 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,160,918 A9S possibly damaging Het
4930407I10Rik C G 15: 82,062,739 T279S probably benign Het
A830018L16Rik A G 1: 11,511,916 probably null Het
Abcg5 T G 17: 84,668,964 I482L probably benign Het
Adgrf5 T A 17: 43,437,571 D44E probably damaging Het
Amh A G 10: 80,805,471 N75S probably benign Het
Arl8a T C 1: 135,152,868 probably null Het
Bpifb4 T C 2: 153,942,560 Y63H possibly damaging Het
Chd5 A T 4: 152,379,421 E1449V probably null Het
Chml A G 1: 175,688,028 V109A probably benign Het
Crybg3 G T 16: 59,554,474 S2139* probably null Het
Cyp2c68 T C 19: 39,734,336 D256G probably damaging Het
Dchs2 G T 3: 83,346,227 V2315L probably damaging Het
Ddx20 T C 3: 105,683,420 I227V possibly damaging Het
Drg2 T C 11: 60,462,625 V266A possibly damaging Het
Flcn C A 11: 59,792,622 E576D probably benign Het
Gm14496 A G 2: 181,997,530 Q471R probably benign Het
Gm43772 T C 5: 66,174,991 probably benign Het
Gpc6 C T 14: 117,951,261 H436Y probably damaging Het
Gpr179 A T 11: 97,335,802 C1842* probably null Het
Ints8 G A 4: 11,208,845 T934I possibly damaging Het
Iqsec1 G T 6: 90,660,987 C1050* probably null Het
Larp4b T C 13: 9,168,757 V510A probably benign Het
Map3k13 A T 16: 21,905,183 D305V possibly damaging Het
Mc5r A T 18: 68,339,247 I226F possibly damaging Het
Mme G A 3: 63,343,508 W323* probably null Het
Mrpl24 A G 3: 87,922,398 Y97C probably benign Het
Mslnl G A 17: 25,746,775 S541N probably benign Het
Npepl1 T C 2: 174,121,057 V412A probably benign Het
Nrg3 T A 14: 39,472,452 K117* probably null Het
Olfr1275 T C 2: 111,230,930 T288A probably benign Het
Olfr736 G T 14: 50,393,491 C245F probably damaging Het
Orc2 A T 1: 58,467,692 M447K probably benign Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Plxnc1 T C 10: 94,793,290 I1541V possibly damaging Het
Rapgef4 T C 2: 72,179,949 Y284H possibly damaging Het
Rnf180 C A 13: 105,181,449 probably null Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slc4a10 A G 2: 62,268,872 M625V probably benign Het
Synpo T A 18: 60,603,615 M420L probably benign Het
Tmem116 A C 5: 121,517,892 *147C probably null Het
Top2b G A 14: 16,423,779 probably null Het
Trp53bp2 T A 1: 182,455,740 C1014S probably damaging Het
Unc5b A G 10: 60,765,360 F896L probably damaging Het
Vil1 T C 1: 74,419,867 W177R probably damaging Het
Vmn2r107 A T 17: 20,375,054 Y623F probably benign Het
Vmn2r86 T C 10: 130,453,666 Y120C probably damaging Het
Wdr18 A G 10: 79,965,343 T197A possibly damaging Het
Ylpm1 A G 12: 85,029,290 M472V probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp677 A G 17: 21,397,656 Y325C probably damaging Het
Zfyve1 A G 12: 83,558,704 F407S probably damaging Het
Other mutations in Fstl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Fstl5 APN 3 76707828 missense probably benign 0.30
IGL01658:Fstl5 APN 3 76482255 missense possibly damaging 0.70
IGL01917:Fstl5 APN 3 76707846 missense probably damaging 1.00
IGL02073:Fstl5 APN 3 76659652 splice site probably benign
IGL02329:Fstl5 APN 3 76588995 missense probably damaging 1.00
IGL02651:Fstl5 APN 3 76593534 missense probably damaging 1.00
IGL02967:Fstl5 APN 3 76322191 missense probably damaging 1.00
IGL03004:Fstl5 APN 3 76648431 splice site probably benign
IGL03107:Fstl5 APN 3 76536311 missense probably damaging 1.00
IGL03113:Fstl5 APN 3 76429792 nonsense probably null
P0038:Fstl5 UTSW 3 76145062 missense probably damaging 1.00
PIT4131001:Fstl5 UTSW 3 76659699 missense probably damaging 0.99
R0015:Fstl5 UTSW 3 76322191 missense probably damaging 1.00
R0015:Fstl5 UTSW 3 76322191 missense probably damaging 1.00
R0032:Fstl5 UTSW 3 76648435 splice site probably benign
R0032:Fstl5 UTSW 3 76648435 splice site probably benign
R0078:Fstl5 UTSW 3 76659645 splice site probably benign
R0137:Fstl5 UTSW 3 76707479 missense probably damaging 1.00
R0183:Fstl5 UTSW 3 76322272 missense possibly damaging 0.86
R0330:Fstl5 UTSW 3 76707753 missense possibly damaging 0.80
R0427:Fstl5 UTSW 3 76707727 nonsense probably null
R0687:Fstl5 UTSW 3 76707812 missense possibly damaging 0.62
R1642:Fstl5 UTSW 3 76410622 missense possibly damaging 0.80
R1765:Fstl5 UTSW 3 76593476 missense possibly damaging 0.90
R1900:Fstl5 UTSW 3 76708160 missense probably damaging 1.00
R1996:Fstl5 UTSW 3 76707834 missense probably benign 0.19
R2157:Fstl5 UTSW 3 76708065 missense possibly damaging 0.46
R2228:Fstl5 UTSW 3 76482352 missense probably damaging 1.00
R2851:Fstl5 UTSW 3 76429738 splice site probably benign
R4021:Fstl5 UTSW 3 76628975 missense probably benign 0.00
R4086:Fstl5 UTSW 3 76648286 missense probably damaging 1.00
R4777:Fstl5 UTSW 3 76593500 missense probably damaging 1.00
R4829:Fstl5 UTSW 3 76322182 missense probably damaging 1.00
R4934:Fstl5 UTSW 3 76588965 missense probably damaging 1.00
R4955:Fstl5 UTSW 3 76223876 critical splice donor site probably null
R4977:Fstl5 UTSW 3 76410494 nonsense probably null
R5166:Fstl5 UTSW 3 76628960 missense possibly damaging 0.86
R5232:Fstl5 UTSW 3 76144977 missense possibly damaging 0.89
R5313:Fstl5 UTSW 3 76593505 missense possibly damaging 0.90
R5584:Fstl5 UTSW 3 76322267 missense probably damaging 1.00
R5647:Fstl5 UTSW 3 76589092 missense probably damaging 1.00
R5842:Fstl5 UTSW 3 76322283 missense possibly damaging 0.94
R5978:Fstl5 UTSW 3 76145085 missense probably damaging 1.00
R6064:Fstl5 UTSW 3 76322298 missense probably benign 0.13
R6327:Fstl5 UTSW 3 76707801 missense probably benign 0.31
R6386:Fstl5 UTSW 3 76322066 missense probably benign 0.13
R6523:Fstl5 UTSW 3 76536334 missense probably benign 0.00
R6852:Fstl5 UTSW 3 76707855 missense probably damaging 1.00
R6861:Fstl5 UTSW 3 76322216 missense probably damaging 1.00
R6866:Fstl5 UTSW 3 76322225 missense probably damaging 0.99
R7100:Fstl5 UTSW 3 76536293 missense probably benign 0.11
R7341:Fstl5 UTSW 3 76482397 splice site probably null
R7495:Fstl5 UTSW 3 76707792 missense possibly damaging 0.85
R7558:Fstl5 UTSW 3 76429785 missense possibly damaging 0.95
R7731:Fstl5 UTSW 3 76661762 missense probably damaging 1.00
R7787:Fstl5 UTSW 3 76429824 missense probably damaging 1.00
R7852:Fstl5 UTSW 3 76707968 missense probably benign 0.00
R7874:Fstl5 UTSW 3 76661786 missense probably benign 0.10
R7881:Fstl5 UTSW 3 76536298 missense probably damaging 1.00
R7935:Fstl5 UTSW 3 76707968 missense probably benign 0.00
R7957:Fstl5 UTSW 3 76661786 missense probably benign 0.10
R7964:Fstl5 UTSW 3 76536298 missense probably damaging 1.00
R8039:Fstl5 UTSW 3 76648418 missense possibly damaging 0.69
R8050:Fstl5 UTSW 3 76707503 missense probably benign 0.00
Z1176:Fstl5 UTSW 3 76707982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCATGGGACTAGTTCATTTAC -3'
(R):5'- AGGTCGGTTTCAACCCCATC -3'

Sequencing Primer
(F):5'- GGGACTAGTTCATTTACTTTTCCAAG -3'
(R):5'- TCCACTGCATATATCTCCATAACCAG -3'
Posted On2017-06-26