Incidental Mutation 'R6007:Dchs2'
ID 479529
Institutional Source Beutler Lab
Gene Symbol Dchs2
Ensembl Gene ENSMUSG00000102692
Gene Name dachsous cadherin related 2
Synonyms LOC229459
MMRRC Submission 044184-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.249) question?
Stock # R6007 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 83127948-83357209 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 83346227 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 2315 (V2315L)
Ref Sequence ENSEMBL: ENSMUSP00000141425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191829]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000191829
AA Change: V2315L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141425
Gene: ENSMUSG00000102692
AA Change: V2315L

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
CA 70 149 1.6e-8 SMART
CA 173 278 1.9e-9 SMART
CA 302 395 2e-33 SMART
CA 423 522 3.2e-7 SMART
CA 546 642 1.1e-29 SMART
CA 666 750 5.6e-22 SMART
CA 774 855 1.5e-8 SMART
CA 876 958 4.2e-19 SMART
CA 982 1060 3e-8 SMART
CA 1067 1168 9.3e-7 SMART
CA 1192 1271 1.1e-28 SMART
CA 1299 1379 4e-16 SMART
CA 1403 1486 6.1e-16 SMART
CA 1510 1596 3.5e-18 SMART
CA 1619 1700 4.4e-27 SMART
CA 1724 1805 6.4e-27 SMART
CA 1828 1909 4.3e-29 SMART
CA 1933 2014 3.4e-27 SMART
CA 2038 2116 4.2e-7 SMART
CA 2139 2218 2.5e-15 SMART
CA 2242 2323 2.1e-34 SMART
CA 2346 2423 3e-24 SMART
CA 2447 2525 2e-17 SMART
CA 2549 2641 9.8e-16 SMART
CA 2665 2745 2.3e-24 SMART
CA 2769 2856 5.9e-19 SMART
CA 2880 2959 1e-3 SMART
transmembrane domain 2973 2995 N/A INTRINSIC
Meta Mutation Damage Score 0.3548 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,160,918 A9S possibly damaging Het
4930407I10Rik C G 15: 82,062,739 T279S probably benign Het
A830018L16Rik A G 1: 11,511,916 probably null Het
Abcg5 T G 17: 84,668,964 I482L probably benign Het
Adgrf5 T A 17: 43,437,571 D44E probably damaging Het
Amh A G 10: 80,805,471 N75S probably benign Het
Arl8a T C 1: 135,152,868 probably null Het
Bpifb4 T C 2: 153,942,560 Y63H possibly damaging Het
Chd5 A T 4: 152,379,421 E1449V probably null Het
Chml A G 1: 175,688,028 V109A probably benign Het
Crybg3 G T 16: 59,554,474 S2139* probably null Het
Cyp2c68 T C 19: 39,734,336 D256G probably damaging Het
Ddx20 T C 3: 105,683,420 I227V possibly damaging Het
Drg2 T C 11: 60,462,625 V266A possibly damaging Het
Flcn C A 11: 59,792,622 E576D probably benign Het
Fstl5 T A 3: 76,410,592 D188E probably damaging Het
Gm14496 A G 2: 181,997,530 Q471R probably benign Het
Gm43772 T C 5: 66,174,991 probably benign Het
Gpc6 C T 14: 117,951,261 H436Y probably damaging Het
Gpr179 A T 11: 97,335,802 C1842* probably null Het
Ints8 G A 4: 11,208,845 T934I possibly damaging Het
Iqsec1 G T 6: 90,660,987 C1050* probably null Het
Larp4b T C 13: 9,168,757 V510A probably benign Het
Map3k13 A T 16: 21,905,183 D305V possibly damaging Het
Mc5r A T 18: 68,339,247 I226F possibly damaging Het
Mme G A 3: 63,343,508 W323* probably null Het
Mrpl24 A G 3: 87,922,398 Y97C probably benign Het
Mslnl G A 17: 25,746,775 S541N probably benign Het
Npepl1 T C 2: 174,121,057 V412A probably benign Het
Nrg3 T A 14: 39,472,452 K117* probably null Het
Olfr1275 T C 2: 111,230,930 T288A probably benign Het
Olfr736 G T 14: 50,393,491 C245F probably damaging Het
Orc2 A T 1: 58,467,692 M447K probably benign Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Plxnc1 T C 10: 94,793,290 I1541V possibly damaging Het
Rapgef4 T C 2: 72,179,949 Y284H possibly damaging Het
Rnf180 C A 13: 105,181,449 probably null Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slc4a10 A G 2: 62,268,872 M625V probably benign Het
Synpo T A 18: 60,603,615 M420L probably benign Het
Tmem116 A C 5: 121,517,892 *147C probably null Het
Top2b G A 14: 16,423,779 probably null Het
Trp53bp2 T A 1: 182,455,740 C1014S probably damaging Het
Unc5b A G 10: 60,765,360 F896L probably damaging Het
Vil1 T C 1: 74,419,867 W177R probably damaging Het
Vmn2r107 A T 17: 20,375,054 Y623F probably benign Het
Vmn2r86 T C 10: 130,453,666 Y120C probably damaging Het
Wdr18 A G 10: 79,965,343 T197A possibly damaging Het
Ylpm1 A G 12: 85,029,290 M472V probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp677 A G 17: 21,397,656 Y325C probably damaging Het
Zfyve1 A G 12: 83,558,704 F407S probably damaging Het
Other mutations in Dchs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1707:Dchs2 UTSW 3 83127605 unclassified probably benign
R5857:Dchs2 UTSW 3 83270313 missense possibly damaging 0.79
R5897:Dchs2 UTSW 3 83285410 missense possibly damaging 0.95
R5959:Dchs2 UTSW 3 83325418 missense probably benign 0.01
R6054:Dchs2 UTSW 3 83346236 missense probably benign 0.00
R6059:Dchs2 UTSW 3 83355736 missense probably benign 0.06
R6075:Dchs2 UTSW 3 83355061 missense possibly damaging 0.68
R6379:Dchs2 UTSW 3 83355146 missense probably damaging 1.00
R6393:Dchs2 UTSW 3 83129911 missense probably damaging 1.00
R6405:Dchs2 UTSW 3 83354263 missense probably benign 0.01
R6432:Dchs2 UTSW 3 83271118 missense possibly damaging 0.96
R6434:Dchs2 UTSW 3 83269270 missense probably damaging 1.00
R6561:Dchs2 UTSW 3 83129169 missense probably benign 0.04
R6798:Dchs2 UTSW 3 83348286 missense probably damaging 1.00
R6801:Dchs2 UTSW 3 83128534 missense probably benign 0.00
R6855:Dchs2 UTSW 3 83348194 missense probably benign 0.08
R6956:Dchs2 UTSW 3 83353926 missense probably benign 0.00
R7090:Dchs2 UTSW 3 83348274 missense probably benign 0.03
R7249:Dchs2 UTSW 3 83128029 nonsense probably null
R7252:Dchs2 UTSW 3 83325303 missense probably benign 0.04
R7462:Dchs2 UTSW 3 83346155 splice site probably null
R7482:Dchs2 UTSW 3 83248725 missense possibly damaging 0.68
R7487:Dchs2 UTSW 3 83356306 missense probably damaging 0.99
R7529:Dchs2 UTSW 3 83354398 missense possibly damaging 0.89
R7542:Dchs2 UTSW 3 83269284 missense probably benign 0.16
R7544:Dchs2 UTSW 3 83355127 missense probably damaging 1.00
R7547:Dchs2 UTSW 3 83356127 missense probably damaging 0.96
R7587:Dchs2 UTSW 3 83304515 missense probably benign
R7632:Dchs2 UTSW 3 83348050 missense probably benign 0.00
R7694:Dchs2 UTSW 3 83129482 missense probably damaging 1.00
R7701:Dchs2 UTSW 3 83346206 missense possibly damaging 0.83
R7746:Dchs2 UTSW 3 83128057 missense possibly damaging 0.94
R7838:Dchs2 UTSW 3 83304527 missense probably benign 0.01
R7886:Dchs2 UTSW 3 83305085 missense probably damaging 1.00
R8055:Dchs2 UTSW 3 83129725 missense probably benign 0.00
R8068:Dchs2 UTSW 3 83300438 missense probably benign 0.12
R8094:Dchs2 UTSW 3 83355622 missense probably benign 0.02
R8160:Dchs2 UTSW 3 83270805 missense probably benign 0.19
R8166:Dchs2 UTSW 3 83354333 missense probably benign 0.28
R8278:Dchs2 UTSW 3 83271003 missense probably damaging 1.00
R8422:Dchs2 UTSW 3 83325263 missense probably benign 0.30
R8506:Dchs2 UTSW 3 83301174 missense probably benign 0.17
R8517:Dchs2 UTSW 3 83271112 missense probably damaging 0.96
R8528:Dchs2 UTSW 3 83354611 missense probably damaging 0.96
R8693:Dchs2 UTSW 3 83285324 missense probably damaging 1.00
R8708:Dchs2 UTSW 3 83128742 missense probably benign 0.00
R8757:Dchs2 UTSW 3 83354260 missense possibly damaging 0.96
R8768:Dchs2 UTSW 3 83346285 missense probably benign 0.12
R8776:Dchs2 UTSW 3 83356394 missense possibly damaging 0.46
R8776-TAIL:Dchs2 UTSW 3 83356394 missense possibly damaging 0.46
R8802:Dchs2 UTSW 3 83346237 missense probably benign 0.01
R8821:Dchs2 UTSW 3 83285363 missense probably benign 0.00
R8831:Dchs2 UTSW 3 83285363 missense probably benign 0.00
R8897:Dchs2 UTSW 3 83129413 missense probably damaging 1.00
R8957:Dchs2 UTSW 3 83282266 missense
R8973:Dchs2 UTSW 3 83354456 missense possibly damaging 0.86
R8991:Dchs2 UTSW 3 83128836 missense probably benign 0.00
R9015:Dchs2 UTSW 3 83281444 missense possibly damaging 0.86
R9051:Dchs2 UTSW 3 83354186 missense probably benign 0.02
R9117:Dchs2 UTSW 3 83269355 missense probably benign 0.31
R9120:Dchs2 UTSW 3 83280228 missense probably damaging 0.99
R9189:Dchs2 UTSW 3 83348254 missense probably damaging 1.00
R9264:Dchs2 UTSW 3 83270477 missense probably damaging 1.00
R9280:Dchs2 UTSW 3 83281948 missense possibly damaging 0.88
R9293:Dchs2 UTSW 3 83282054 missense possibly damaging 0.90
R9322:Dchs2 UTSW 3 83281694 missense possibly damaging 0.73
R9345:Dchs2 UTSW 3 83128794 missense probably benign 0.00
R9408:Dchs2 UTSW 3 83285266 missense probably benign 0.02
R9432:Dchs2 UTSW 3 83128725 missense possibly damaging 0.65
R9445:Dchs2 UTSW 3 83238977 missense probably damaging 0.99
R9466:Dchs2 UTSW 3 83269257 missense probably damaging 1.00
R9612:Dchs2 UTSW 3 83270886 missense probably damaging 0.97
R9622:Dchs2 UTSW 3 83356459 nonsense probably null
R9679:Dchs2 UTSW 3 83354390 missense probably damaging 0.99
R9722:Dchs2 UTSW 3 83353994 missense probably benign 0.01
R9767:Dchs2 UTSW 3 83304899 missense probably benign 0.01
RF012:Dchs2 UTSW 3 83355068 missense probably benign 0.03
Z1177:Dchs2 UTSW 3 83271140 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCTATTTAGAAAATGCCATGGGAG -3'
(R):5'- TGAACGCAAATCCAAGTGTTAG -3'

Sequencing Primer
(F):5'- ATGCCATGGGAGAAATAAATGTC -3'
(R):5'- CCAAGTGTTAGGATATAAAGCCCTTG -3'
Posted On 2017-06-26