Incidental Mutation 'R6007:Plxnc1'
ID479539
Institutional Source Beutler Lab
Gene Symbol Plxnc1
Ensembl Gene ENSMUSG00000074785
Gene Nameplexin C1
SynonymsCD232, vespr, 2510048K12Rik
MMRRC Submission 044184-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.645) question?
Stock #R6007 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location94790866-94944835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94793290 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1541 (I1541V)
Ref Sequence ENSEMBL: ENSMUSP00000096939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020212] [ENSMUST00000099337]
Predicted Effect probably benign
Transcript: ENSMUST00000020212
SMART Domains Protein: ENSMUSP00000020212
Gene: ENSMUSG00000020024

DomainStartEndE-ValueType
coiled coil region 31 100 N/A INTRINSIC
coiled coil region 121 602 N/A INTRINSIC
coiled coil region 656 689 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099337
AA Change: I1541V

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: I1541V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218076
Meta Mutation Damage Score 0.1741 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,160,918 A9S possibly damaging Het
4930407I10Rik C G 15: 82,062,739 T279S probably benign Het
A830018L16Rik A G 1: 11,511,916 probably null Het
Abcg5 T G 17: 84,668,964 I482L probably benign Het
Adgrf5 T A 17: 43,437,571 D44E probably damaging Het
Amh A G 10: 80,805,471 N75S probably benign Het
Arl8a T C 1: 135,152,868 probably null Het
Bpifb4 T C 2: 153,942,560 Y63H possibly damaging Het
Chd5 A T 4: 152,379,421 E1449V probably null Het
Chml A G 1: 175,688,028 V109A probably benign Het
Crybg3 G T 16: 59,554,474 S2139* probably null Het
Cyp2c68 T C 19: 39,734,336 D256G probably damaging Het
Dchs2 G T 3: 83,346,227 V2315L probably damaging Het
Ddx20 T C 3: 105,683,420 I227V possibly damaging Het
Drg2 T C 11: 60,462,625 V266A possibly damaging Het
Flcn C A 11: 59,792,622 E576D probably benign Het
Fstl5 T A 3: 76,410,592 D188E probably damaging Het
Gm14496 A G 2: 181,997,530 Q471R probably benign Het
Gm43772 T C 5: 66,174,991 probably benign Het
Gpc6 C T 14: 117,951,261 H436Y probably damaging Het
Gpr179 A T 11: 97,335,802 C1842* probably null Het
Ints8 G A 4: 11,208,845 T934I possibly damaging Het
Iqsec1 G T 6: 90,660,987 C1050* probably null Het
Larp4b T C 13: 9,168,757 V510A probably benign Het
Map3k13 A T 16: 21,905,183 D305V possibly damaging Het
Mc5r A T 18: 68,339,247 I226F possibly damaging Het
Mme G A 3: 63,343,508 W323* probably null Het
Mrpl24 A G 3: 87,922,398 Y97C probably benign Het
Mslnl G A 17: 25,746,775 S541N probably benign Het
Npepl1 T C 2: 174,121,057 V412A probably benign Het
Nrg3 T A 14: 39,472,452 K117* probably null Het
Olfr1275 T C 2: 111,230,930 T288A probably benign Het
Olfr736 G T 14: 50,393,491 C245F probably damaging Het
Orc2 A T 1: 58,467,692 M447K probably benign Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Rapgef4 T C 2: 72,179,949 Y284H possibly damaging Het
Rnf180 C A 13: 105,181,449 probably null Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slc4a10 A G 2: 62,268,872 M625V probably benign Het
Synpo T A 18: 60,603,615 M420L probably benign Het
Tmem116 A C 5: 121,517,892 *147C probably null Het
Top2b G A 14: 16,423,779 probably null Het
Trp53bp2 T A 1: 182,455,740 C1014S probably damaging Het
Unc5b A G 10: 60,765,360 F896L probably damaging Het
Vil1 T C 1: 74,419,867 W177R probably damaging Het
Vmn2r107 A T 17: 20,375,054 Y623F probably benign Het
Vmn2r86 T C 10: 130,453,666 Y120C probably damaging Het
Wdr18 A G 10: 79,965,343 T197A possibly damaging Het
Ylpm1 A G 12: 85,029,290 M472V probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp677 A G 17: 21,397,656 Y325C probably damaging Het
Zfyve1 A G 12: 83,558,704 F407S probably damaging Het
Other mutations in Plxnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Plxnc1 APN 10 94847549 missense probably benign 0.25
IGL01285:Plxnc1 APN 10 94799368 missense probably damaging 0.99
IGL01867:Plxnc1 APN 10 94798146 missense possibly damaging 0.61
IGL01994:Plxnc1 APN 10 94849939 missense probably damaging 1.00
IGL02083:Plxnc1 APN 10 94922725 missense possibly damaging 0.61
IGL02250:Plxnc1 APN 10 94871031 missense probably benign 0.00
IGL02429:Plxnc1 APN 10 94882591 missense probably benign 0.00
IGL02752:Plxnc1 APN 10 94794680 unclassified probably null
IGL02973:Plxnc1 APN 10 94810684 missense probably damaging 1.00
R0230:Plxnc1 UTSW 10 94799347 missense probably benign 0.07
R0265:Plxnc1 UTSW 10 94813129 missense probably benign 0.14
R0271:Plxnc1 UTSW 10 94837918 missense probably null 1.00
R0299:Plxnc1 UTSW 10 94849821 critical splice donor site probably null
R0361:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
R0441:Plxnc1 UTSW 10 94796482 missense probably damaging 1.00
R0558:Plxnc1 UTSW 10 94837935 missense probably damaging 1.00
R0617:Plxnc1 UTSW 10 94799368 missense probably damaging 1.00
R0671:Plxnc1 UTSW 10 94799332 missense possibly damaging 0.63
R0692:Plxnc1 UTSW 10 94837500 critical splice donor site probably null
R0751:Plxnc1 UTSW 10 94831333 splice site probably benign
R1184:Plxnc1 UTSW 10 94831333 splice site probably benign
R1260:Plxnc1 UTSW 10 94831365 missense probably damaging 0.99
R1680:Plxnc1 UTSW 10 94841551 missense probably benign 0.14
R1746:Plxnc1 UTSW 10 94844179 splice site probably null
R1750:Plxnc1 UTSW 10 94799497 missense probably damaging 1.00
R1751:Plxnc1 UTSW 10 94849815 unclassified probably benign
R1768:Plxnc1 UTSW 10 94844322 missense probably benign 0.05
R1876:Plxnc1 UTSW 10 94866941 missense possibly damaging 0.94
R2004:Plxnc1 UTSW 10 94852622 missense probably damaging 0.98
R2031:Plxnc1 UTSW 10 94943667 missense probably benign 0.26
R2184:Plxnc1 UTSW 10 94944269 missense probably damaging 1.00
R2437:Plxnc1 UTSW 10 94906533 missense probably benign 0.02
R2927:Plxnc1 UTSW 10 94793292 critical splice acceptor site probably null
R3001:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3002:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3003:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3441:Plxnc1 UTSW 10 94871010 missense probably benign 0.00
R3849:Plxnc1 UTSW 10 94794432 missense probably benign 0.01
R3884:Plxnc1 UTSW 10 94910687 intron probably null
R4004:Plxnc1 UTSW 10 94794597 nonsense probably null
R4679:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
R4730:Plxnc1 UTSW 10 94867468 intron probably benign
R4937:Plxnc1 UTSW 10 94841473 missense probably damaging 1.00
R5068:Plxnc1 UTSW 10 94799377 missense possibly damaging 0.91
R5345:Plxnc1 UTSW 10 94849969 missense probably benign 0.26
R5397:Plxnc1 UTSW 10 94843752 missense probably benign 0.08
R5416:Plxnc1 UTSW 10 94837554 missense probably damaging 1.00
R5485:Plxnc1 UTSW 10 94922742 missense probably benign 0.00
R5543:Plxnc1 UTSW 10 94864774 missense probably benign
R5826:Plxnc1 UTSW 10 94799473 critical splice donor site probably null
R6018:Plxnc1 UTSW 10 94943848 missense probably benign 0.21
R6052:Plxnc1 UTSW 10 94943773 missense probably benign 0.13
R6291:Plxnc1 UTSW 10 94833642 splice site probably null
R6653:Plxnc1 UTSW 10 94943876 missense probably damaging 1.00
R6984:Plxnc1 UTSW 10 94831530 missense probably damaging 1.00
R7086:Plxnc1 UTSW 10 94831435 missense probably benign
R7401:Plxnc1 UTSW 10 94871005 missense probably benign
R7727:Plxnc1 UTSW 10 94944109 missense probably damaging 1.00
R7789:Plxnc1 UTSW 10 94794477 missense probably damaging 1.00
R7803:Plxnc1 UTSW 10 94943515 critical splice donor site probably null
R7809:Plxnc1 UTSW 10 94794440 missense probably damaging 1.00
R7882:Plxnc1 UTSW 10 94843836 missense probably benign
R7965:Plxnc1 UTSW 10 94843836 missense probably benign
RF003:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
RF045:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF046:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF047:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
X0024:Plxnc1 UTSW 10 94864715 critical splice donor site probably null
Z1176:Plxnc1 UTSW 10 94865029 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATTAACGACAAAGAGTAGCTCAAGC -3'
(R):5'- GCCCAAGTGTTGTTGATCCTG -3'

Sequencing Primer
(F):5'- CTCAAGCAGCCAGTTTGC -3'
(R):5'- GTTGATCCTGTGATAATGACTTAGC -3'
Posted On2017-06-26