Incidental Mutation 'R6007:Plxnc1'
ID 479539
Institutional Source Beutler Lab
Gene Symbol Plxnc1
Ensembl Gene ENSMUSG00000074785
Gene Name plexin C1
Synonyms 2510048K12Rik, vespr, CD232
MMRRC Submission 044184-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.472) question?
Stock # R6007 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 94626728-94780697 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94629152 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1541 (I1541V)
Ref Sequence ENSEMBL: ENSMUSP00000096939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020212] [ENSMUST00000099337]
AlphaFold Q9QZC2
Predicted Effect probably benign
Transcript: ENSMUST00000020212
SMART Domains Protein: ENSMUSP00000020212
Gene: ENSMUSG00000020024

DomainStartEndE-ValueType
coiled coil region 31 100 N/A INTRINSIC
coiled coil region 121 602 N/A INTRINSIC
coiled coil region 656 689 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099337
AA Change: I1541V

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: I1541V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218076
Meta Mutation Damage Score 0.1741 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,137,900 (GRCm39) A9S possibly damaging Het
4930407I10Rik C G 15: 81,946,940 (GRCm39) T279S probably benign Het
A830018L16Rik A G 1: 11,582,140 (GRCm39) probably null Het
Abcg5 T G 17: 84,976,392 (GRCm39) I482L probably benign Het
Adgrf5 T A 17: 43,748,462 (GRCm39) D44E probably damaging Het
Amh A G 10: 80,641,305 (GRCm39) N75S probably benign Het
Arl8a T C 1: 135,080,606 (GRCm39) probably null Het
Bpifb4 T C 2: 153,784,480 (GRCm39) Y63H possibly damaging Het
Chd5 A T 4: 152,463,878 (GRCm39) E1449V probably null Het
Chml A G 1: 175,515,594 (GRCm39) V109A probably benign Het
Crybg3 G T 16: 59,374,837 (GRCm39) S2139* probably null Het
Cyp2c68 T C 19: 39,722,780 (GRCm39) D256G probably damaging Het
Dchs2 G T 3: 83,253,534 (GRCm39) V2315L probably damaging Het
Ddx20 T C 3: 105,590,736 (GRCm39) I227V possibly damaging Het
Drg2 T C 11: 60,353,451 (GRCm39) V266A possibly damaging Het
Flcn C A 11: 59,683,448 (GRCm39) E576D probably benign Het
Fstl5 T A 3: 76,317,899 (GRCm39) D188E probably damaging Het
Gm14496 A G 2: 181,639,323 (GRCm39) Q471R probably benign Het
Gm43772 T C 5: 66,332,334 (GRCm39) probably benign Het
Gpc6 C T 14: 118,188,673 (GRCm39) H436Y probably damaging Het
Gpr179 A T 11: 97,226,628 (GRCm39) C1842* probably null Het
Ints8 G A 4: 11,208,845 (GRCm39) T934I possibly damaging Het
Iqsec1 G T 6: 90,637,969 (GRCm39) C1050* probably null Het
Larp4b T C 13: 9,218,793 (GRCm39) V510A probably benign Het
Map3k13 A T 16: 21,723,933 (GRCm39) D305V possibly damaging Het
Mc5r A T 18: 68,472,318 (GRCm39) I226F possibly damaging Het
Mme G A 3: 63,250,929 (GRCm39) W323* probably null Het
Mrpl24 A G 3: 87,829,705 (GRCm39) Y97C probably benign Het
Mslnl G A 17: 25,965,749 (GRCm39) S541N probably benign Het
Npepl1 T C 2: 173,962,850 (GRCm39) V412A probably benign Het
Nrg3 T A 14: 39,194,409 (GRCm39) K117* probably null Het
Or11j4 G T 14: 50,630,948 (GRCm39) C245F probably damaging Het
Or4f52 T C 2: 111,061,275 (GRCm39) T288A probably benign Het
Orc2 A T 1: 58,506,851 (GRCm39) M447K probably benign Het
Phf3 A T 1: 30,843,426 (GRCm39) H1844Q probably damaging Het
Rapgef4 T C 2: 72,010,293 (GRCm39) Y284H possibly damaging Het
Rnf180 C A 13: 105,317,957 (GRCm39) probably null Het
Secisbp2 T C 13: 51,819,395 (GRCm39) I325T probably damaging Het
Sertad2 G A 11: 20,597,884 (GRCm39) G27S probably benign Het
Slc4a10 A G 2: 62,099,216 (GRCm39) M625V probably benign Het
Synpo T A 18: 60,736,687 (GRCm39) M420L probably benign Het
Tmem116 A C 5: 121,655,955 (GRCm39) *147C probably null Het
Top2b G A 14: 16,423,779 (GRCm38) probably null Het
Trp53bp2 T A 1: 182,283,305 (GRCm39) C1014S probably damaging Het
Unc5b A G 10: 60,601,139 (GRCm39) F896L probably damaging Het
Vil1 T C 1: 74,459,026 (GRCm39) W177R probably damaging Het
Vmn2r107 A T 17: 20,595,316 (GRCm39) Y623F probably benign Het
Vmn2r86 T C 10: 130,289,535 (GRCm39) Y120C probably damaging Het
Wdr18 A G 10: 79,801,177 (GRCm39) T197A possibly damaging Het
Ylpm1 A G 12: 85,076,064 (GRCm39) M472V probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zfp677 A G 17: 21,617,918 (GRCm39) Y325C probably damaging Het
Zfyve1 A G 12: 83,605,478 (GRCm39) F407S probably damaging Het
Other mutations in Plxnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Plxnc1 APN 10 94,683,411 (GRCm39) missense probably benign 0.25
IGL01285:Plxnc1 APN 10 94,635,230 (GRCm39) missense probably damaging 0.99
IGL01867:Plxnc1 APN 10 94,634,008 (GRCm39) missense possibly damaging 0.61
IGL01994:Plxnc1 APN 10 94,685,801 (GRCm39) missense probably damaging 1.00
IGL02083:Plxnc1 APN 10 94,758,587 (GRCm39) missense possibly damaging 0.61
IGL02250:Plxnc1 APN 10 94,706,893 (GRCm39) missense probably benign 0.00
IGL02429:Plxnc1 APN 10 94,718,453 (GRCm39) missense probably benign 0.00
IGL02752:Plxnc1 APN 10 94,630,542 (GRCm39) splice site probably null
IGL02973:Plxnc1 APN 10 94,646,546 (GRCm39) missense probably damaging 1.00
R0230:Plxnc1 UTSW 10 94,635,209 (GRCm39) missense probably benign 0.07
R0265:Plxnc1 UTSW 10 94,648,991 (GRCm39) missense probably benign 0.14
R0271:Plxnc1 UTSW 10 94,673,780 (GRCm39) missense probably null 1.00
R0299:Plxnc1 UTSW 10 94,685,683 (GRCm39) critical splice donor site probably null
R0361:Plxnc1 UTSW 10 94,700,869 (GRCm39) missense probably damaging 1.00
R0441:Plxnc1 UTSW 10 94,632,344 (GRCm39) missense probably damaging 1.00
R0558:Plxnc1 UTSW 10 94,673,797 (GRCm39) missense probably damaging 1.00
R0617:Plxnc1 UTSW 10 94,635,230 (GRCm39) missense probably damaging 1.00
R0671:Plxnc1 UTSW 10 94,635,194 (GRCm39) missense possibly damaging 0.63
R0692:Plxnc1 UTSW 10 94,673,362 (GRCm39) critical splice donor site probably null
R0751:Plxnc1 UTSW 10 94,667,195 (GRCm39) splice site probably benign
R1184:Plxnc1 UTSW 10 94,667,195 (GRCm39) splice site probably benign
R1260:Plxnc1 UTSW 10 94,667,227 (GRCm39) missense probably damaging 0.99
R1680:Plxnc1 UTSW 10 94,677,413 (GRCm39) missense probably benign 0.14
R1746:Plxnc1 UTSW 10 94,680,041 (GRCm39) splice site probably null
R1750:Plxnc1 UTSW 10 94,635,359 (GRCm39) missense probably damaging 1.00
R1751:Plxnc1 UTSW 10 94,685,677 (GRCm39) unclassified probably benign
R1768:Plxnc1 UTSW 10 94,680,184 (GRCm39) missense probably benign 0.05
R1876:Plxnc1 UTSW 10 94,702,803 (GRCm39) missense possibly damaging 0.94
R2004:Plxnc1 UTSW 10 94,688,484 (GRCm39) missense probably damaging 0.98
R2031:Plxnc1 UTSW 10 94,779,529 (GRCm39) missense probably benign 0.26
R2184:Plxnc1 UTSW 10 94,780,131 (GRCm39) missense probably damaging 1.00
R2437:Plxnc1 UTSW 10 94,742,395 (GRCm39) missense probably benign 0.02
R2927:Plxnc1 UTSW 10 94,629,154 (GRCm39) critical splice acceptor site probably null
R3001:Plxnc1 UTSW 10 94,629,080 (GRCm39) missense probably damaging 0.98
R3002:Plxnc1 UTSW 10 94,629,080 (GRCm39) missense probably damaging 0.98
R3003:Plxnc1 UTSW 10 94,629,080 (GRCm39) missense probably damaging 0.98
R3441:Plxnc1 UTSW 10 94,706,872 (GRCm39) missense probably benign 0.00
R3849:Plxnc1 UTSW 10 94,630,294 (GRCm39) missense probably benign 0.01
R3884:Plxnc1 UTSW 10 94,746,549 (GRCm39) splice site probably null
R4004:Plxnc1 UTSW 10 94,630,459 (GRCm39) nonsense probably null
R4679:Plxnc1 UTSW 10 94,630,306 (GRCm39) missense probably damaging 1.00
R4730:Plxnc1 UTSW 10 94,703,330 (GRCm39) intron probably benign
R4937:Plxnc1 UTSW 10 94,677,335 (GRCm39) missense probably damaging 1.00
R5068:Plxnc1 UTSW 10 94,635,239 (GRCm39) missense possibly damaging 0.91
R5345:Plxnc1 UTSW 10 94,685,831 (GRCm39) missense probably benign 0.26
R5397:Plxnc1 UTSW 10 94,679,614 (GRCm39) missense probably benign 0.08
R5416:Plxnc1 UTSW 10 94,673,416 (GRCm39) missense probably damaging 1.00
R5485:Plxnc1 UTSW 10 94,758,604 (GRCm39) missense probably benign 0.00
R5543:Plxnc1 UTSW 10 94,700,636 (GRCm39) missense probably benign
R5826:Plxnc1 UTSW 10 94,635,335 (GRCm39) critical splice donor site probably null
R6018:Plxnc1 UTSW 10 94,779,710 (GRCm39) missense probably benign 0.21
R6052:Plxnc1 UTSW 10 94,779,635 (GRCm39) missense probably benign 0.13
R6291:Plxnc1 UTSW 10 94,669,504 (GRCm39) splice site probably null
R6653:Plxnc1 UTSW 10 94,779,738 (GRCm39) missense probably damaging 1.00
R6984:Plxnc1 UTSW 10 94,667,392 (GRCm39) missense probably damaging 1.00
R7086:Plxnc1 UTSW 10 94,667,297 (GRCm39) missense probably benign
R7401:Plxnc1 UTSW 10 94,706,867 (GRCm39) missense probably benign
R7727:Plxnc1 UTSW 10 94,779,971 (GRCm39) missense probably damaging 1.00
R7789:Plxnc1 UTSW 10 94,630,339 (GRCm39) missense probably damaging 1.00
R7803:Plxnc1 UTSW 10 94,779,377 (GRCm39) critical splice donor site probably null
R7809:Plxnc1 UTSW 10 94,630,302 (GRCm39) missense probably damaging 1.00
R7882:Plxnc1 UTSW 10 94,679,698 (GRCm39) missense probably benign
R8103:Plxnc1 UTSW 10 94,706,944 (GRCm39) missense probably benign
R8226:Plxnc1 UTSW 10 94,669,230 (GRCm39) missense possibly damaging 0.90
R8273:Plxnc1 UTSW 10 94,649,105 (GRCm39) missense probably benign 0.14
R8299:Plxnc1 UTSW 10 94,663,041 (GRCm39) missense probably benign 0.35
R8392:Plxnc1 UTSW 10 94,637,352 (GRCm39) missense possibly damaging 0.75
R8758:Plxnc1 UTSW 10 94,758,607 (GRCm39) missense possibly damaging 0.91
R8806:Plxnc1 UTSW 10 94,635,140 (GRCm39) missense probably damaging 1.00
R8882:Plxnc1 UTSW 10 94,677,428 (GRCm39) missense probably damaging 1.00
R8893:Plxnc1 UTSW 10 94,685,709 (GRCm39) missense probably benign 0.35
R8956:Plxnc1 UTSW 10 94,746,448 (GRCm39) missense probably benign 0.00
R9040:Plxnc1 UTSW 10 94,779,379 (GRCm39) nonsense probably null
R9102:Plxnc1 UTSW 10 94,663,107 (GRCm39) missense probably damaging 1.00
R9225:Plxnc1 UTSW 10 94,629,061 (GRCm39) missense probably damaging 1.00
R9324:Plxnc1 UTSW 10 94,780,685 (GRCm39) start gained probably benign
R9368:Plxnc1 UTSW 10 94,700,599 (GRCm39) nonsense probably null
R9375:Plxnc1 UTSW 10 94,649,093 (GRCm39) missense probably benign 0.20
R9430:Plxnc1 UTSW 10 94,758,544 (GRCm39) missense probably benign 0.01
R9460:Plxnc1 UTSW 10 94,700,895 (GRCm39) missense probably benign
R9498:Plxnc1 UTSW 10 94,649,004 (GRCm39) missense possibly damaging 0.48
RF003:Plxnc1 UTSW 10 94,630,306 (GRCm39) missense probably damaging 1.00
RF045:Plxnc1 UTSW 10 94,700,869 (GRCm39) missense probably damaging 1.00
RF046:Plxnc1 UTSW 10 94,700,869 (GRCm39) missense probably damaging 1.00
RF047:Plxnc1 UTSW 10 94,700,869 (GRCm39) missense probably damaging 1.00
X0024:Plxnc1 UTSW 10 94,700,577 (GRCm39) critical splice donor site probably null
Z1176:Plxnc1 UTSW 10 94,700,891 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATTAACGACAAAGAGTAGCTCAAGC -3'
(R):5'- GCCCAAGTGTTGTTGATCCTG -3'

Sequencing Primer
(F):5'- CTCAAGCAGCCAGTTTGC -3'
(R):5'- GTTGATCCTGTGATAATGACTTAGC -3'
Posted On 2017-06-26