Incidental Mutation 'R6007:Vmn2r86'
ID479540
Institutional Source Beutler Lab
Gene Symbol Vmn2r86
Ensembl Gene ENSMUSG00000092162
Gene Namevomeronasal 2, receptor 86
SynonymsEG625109
MMRRC Submission 044184-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6007 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location130445707-130455894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130453666 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 120 (Y120C)
Ref Sequence ENSEMBL: ENSMUSP00000126596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170257]
Predicted Effect probably damaging
Transcript: ENSMUST00000170257
AA Change: Y120C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126596
Gene: ENSMUSG00000092162
AA Change: Y120C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 425 1.1e-25 PFAM
Pfam:NCD3G 508 562 2.4e-19 PFAM
Pfam:7tm_3 595 829 6.4e-55 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,160,918 A9S possibly damaging Het
4930407I10Rik C G 15: 82,062,739 T279S probably benign Het
A830018L16Rik A G 1: 11,511,916 probably null Het
Abcg5 T G 17: 84,668,964 I482L probably benign Het
Adgrf5 T A 17: 43,437,571 D44E probably damaging Het
Amh A G 10: 80,805,471 N75S probably benign Het
Arl8a T C 1: 135,152,868 probably null Het
Bpifb4 T C 2: 153,942,560 Y63H possibly damaging Het
Chd5 A T 4: 152,379,421 E1449V probably null Het
Chml A G 1: 175,688,028 V109A probably benign Het
Crybg3 G T 16: 59,554,474 S2139* probably null Het
Cyp2c68 T C 19: 39,734,336 D256G probably damaging Het
Dchs2 G T 3: 83,346,227 V2315L probably damaging Het
Ddx20 T C 3: 105,683,420 I227V possibly damaging Het
Drg2 T C 11: 60,462,625 V266A possibly damaging Het
Flcn C A 11: 59,792,622 E576D probably benign Het
Fstl5 T A 3: 76,410,592 D188E probably damaging Het
Gm14496 A G 2: 181,997,530 Q471R probably benign Het
Gm43772 T C 5: 66,174,991 probably benign Het
Gpc6 C T 14: 117,951,261 H436Y probably damaging Het
Gpr179 A T 11: 97,335,802 C1842* probably null Het
Ints8 G A 4: 11,208,845 T934I possibly damaging Het
Iqsec1 G T 6: 90,660,987 C1050* probably null Het
Larp4b T C 13: 9,168,757 V510A probably benign Het
Map3k13 A T 16: 21,905,183 D305V possibly damaging Het
Mc5r A T 18: 68,339,247 I226F possibly damaging Het
Mme G A 3: 63,343,508 W323* probably null Het
Mrpl24 A G 3: 87,922,398 Y97C probably benign Het
Mslnl G A 17: 25,746,775 S541N probably benign Het
Npepl1 T C 2: 174,121,057 V412A probably benign Het
Nrg3 T A 14: 39,472,452 K117* probably null Het
Olfr1275 T C 2: 111,230,930 T288A probably benign Het
Olfr736 G T 14: 50,393,491 C245F probably damaging Het
Orc2 A T 1: 58,467,692 M447K probably benign Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Plxnc1 T C 10: 94,793,290 I1541V possibly damaging Het
Rapgef4 T C 2: 72,179,949 Y284H possibly damaging Het
Rnf180 C A 13: 105,181,449 probably null Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slc4a10 A G 2: 62,268,872 M625V probably benign Het
Synpo T A 18: 60,603,615 M420L probably benign Het
Tmem116 A C 5: 121,517,892 *147C probably null Het
Top2b G A 14: 16,423,779 probably null Het
Trp53bp2 T A 1: 182,455,740 C1014S probably damaging Het
Unc5b A G 10: 60,765,360 F896L probably damaging Het
Vil1 T C 1: 74,419,867 W177R probably damaging Het
Vmn2r107 A T 17: 20,375,054 Y623F probably benign Het
Wdr18 A G 10: 79,965,343 T197A possibly damaging Het
Ylpm1 A G 12: 85,029,290 M472V probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp677 A G 17: 21,397,656 Y325C probably damaging Het
Zfyve1 A G 12: 83,558,704 F407S probably damaging Het
Other mutations in Vmn2r86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Vmn2r86 APN 10 130453026 missense probably damaging 0.99
IGL01328:Vmn2r86 APN 10 130452496 missense possibly damaging 0.78
IGL01377:Vmn2r86 APN 10 130452986 missense probably damaging 0.99
IGL01548:Vmn2r86 APN 10 130446282 missense probably benign 0.22
IGL01804:Vmn2r86 APN 10 130452989 missense probably damaging 0.99
IGL01921:Vmn2r86 APN 10 130455741 missense probably benign 0.00
IGL02406:Vmn2r86 APN 10 130448639 missense possibly damaging 0.81
IGL02625:Vmn2r86 APN 10 130452912 missense probably damaging 1.00
IGL02960:Vmn2r86 APN 10 130453767 missense possibly damaging 0.74
IGL03104:Vmn2r86 APN 10 130446632 missense probably damaging 1.00
R0408:Vmn2r86 UTSW 10 130446854 missense probably damaging 1.00
R0437:Vmn2r86 UTSW 10 130446543 missense probably damaging 1.00
R0577:Vmn2r86 UTSW 10 130452575 missense probably benign 0.04
R0726:Vmn2r86 UTSW 10 130446396 missense probably damaging 1.00
R0811:Vmn2r86 UTSW 10 130453628 missense probably benign 0.00
R0812:Vmn2r86 UTSW 10 130453628 missense probably benign 0.00
R1055:Vmn2r86 UTSW 10 130446357 missense probably damaging 1.00
R1066:Vmn2r86 UTSW 10 130446276 missense probably benign 0.01
R1199:Vmn2r86 UTSW 10 130448574 splice site probably benign
R1332:Vmn2r86 UTSW 10 130446870 missense probably damaging 1.00
R1568:Vmn2r86 UTSW 10 130453141 missense probably benign 0.09
R1866:Vmn2r86 UTSW 10 130446386 missense probably damaging 1.00
R1897:Vmn2r86 UTSW 10 130452445 missense probably damaging 1.00
R2017:Vmn2r86 UTSW 10 130446713 missense probably benign 0.39
R3162:Vmn2r86 UTSW 10 130455804 missense probably damaging 0.99
R3162:Vmn2r86 UTSW 10 130455804 missense probably damaging 0.99
R3858:Vmn2r86 UTSW 10 130455725 missense probably benign
R4049:Vmn2r86 UTSW 10 130447097 missense probably damaging 0.98
R4378:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4411:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4413:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4422:Vmn2r86 UTSW 10 130452976 missense possibly damaging 0.87
R4738:Vmn2r86 UTSW 10 130447070 missense probably damaging 0.99
R4767:Vmn2r86 UTSW 10 130455737 missense probably benign 0.00
R4872:Vmn2r86 UTSW 10 130453591 missense probably damaging 0.98
R4880:Vmn2r86 UTSW 10 130453615 missense probably benign 0.33
R5092:Vmn2r86 UTSW 10 130446587 missense probably damaging 1.00
R5421:Vmn2r86 UTSW 10 130446936 missense probably benign 0.41
R6330:Vmn2r86 UTSW 10 130446527 missense probably benign 0.05
R6355:Vmn2r86 UTSW 10 130455894 start codon destroyed probably damaging 0.98
R6397:Vmn2r86 UTSW 10 130446262 nonsense probably null
R6419:Vmn2r86 UTSW 10 130446926 missense probably damaging 1.00
R6933:Vmn2r86 UTSW 10 130446257 missense probably damaging 1.00
R6937:Vmn2r86 UTSW 10 130448654 missense probably damaging 1.00
R6959:Vmn2r86 UTSW 10 130446531 missense probably damaging 1.00
R7010:Vmn2r86 UTSW 10 130455857 missense probably benign
R7549:Vmn2r86 UTSW 10 130446828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACACTCATAAATTCATGCTGTC -3'
(R):5'- GCTCTAACGATCTCTAATATATGAGGC -3'

Sequencing Primer
(F):5'- TTACCGTTGGTGTCCAAG -3'
(R):5'- AGTTAGCATGTCTCATTCTACAAAC -3'
Posted On2017-06-26