Incidental Mutation 'R6007:Drg2'
ID479543
Institutional Source Beutler Lab
Gene Symbol Drg2
Ensembl Gene ENSMUSG00000020537
Gene Namedevelopmentally regulated GTP binding protein 2
Synonyms
MMRRC Submission 044184-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R6007 (G1)
Quality Score223.009
Status Validated
Chromosome11
Chromosomal Location60454591-60468754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60462625 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 266 (V266A)
Ref Sequence ENSEMBL: ENSMUSP00000018568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018568]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018568
AA Change: V266A

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000018568
Gene: ENSMUSG00000020537
AA Change: V266A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:FeoB_N 63 169 1.4e-10 PFAM
Pfam:MMR_HSR1 64 180 1.5e-19 PFAM
Pfam:MMR_HSR1_Xtn 184 289 9.6e-50 PFAM
Pfam:TGS 290 363 2.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155731
Meta Mutation Damage Score 0.7991 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTP-binding protein known to function in the regulation of cell growth and differentiation. Read-through transcripts containing this gene and a downstream gene have been identified, but they are not thought to encode a fusion protein. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,160,918 A9S possibly damaging Het
4930407I10Rik C G 15: 82,062,739 T279S probably benign Het
A830018L16Rik A G 1: 11,511,916 probably null Het
Abcg5 T G 17: 84,668,964 I482L probably benign Het
Adgrf5 T A 17: 43,437,571 D44E probably damaging Het
Amh A G 10: 80,805,471 N75S probably benign Het
Arl8a T C 1: 135,152,868 probably null Het
Bpifb4 T C 2: 153,942,560 Y63H possibly damaging Het
Chd5 A T 4: 152,379,421 E1449V probably null Het
Chml A G 1: 175,688,028 V109A probably benign Het
Crybg3 G T 16: 59,554,474 S2139* probably null Het
Cyp2c68 T C 19: 39,734,336 D256G probably damaging Het
Dchs2 G T 3: 83,346,227 V2315L probably damaging Het
Ddx20 T C 3: 105,683,420 I227V possibly damaging Het
Flcn C A 11: 59,792,622 E576D probably benign Het
Fstl5 T A 3: 76,410,592 D188E probably damaging Het
Gm14496 A G 2: 181,997,530 Q471R probably benign Het
Gm43772 T C 5: 66,174,991 probably benign Het
Gpc6 C T 14: 117,951,261 H436Y probably damaging Het
Gpr179 A T 11: 97,335,802 C1842* probably null Het
Ints8 G A 4: 11,208,845 T934I possibly damaging Het
Iqsec1 G T 6: 90,660,987 C1050* probably null Het
Larp4b T C 13: 9,168,757 V510A probably benign Het
Map3k13 A T 16: 21,905,183 D305V possibly damaging Het
Mc5r A T 18: 68,339,247 I226F possibly damaging Het
Mme G A 3: 63,343,508 W323* probably null Het
Mrpl24 A G 3: 87,922,398 Y97C probably benign Het
Mslnl G A 17: 25,746,775 S541N probably benign Het
Npepl1 T C 2: 174,121,057 V412A probably benign Het
Nrg3 T A 14: 39,472,452 K117* probably null Het
Olfr1275 T C 2: 111,230,930 T288A probably benign Het
Olfr736 G T 14: 50,393,491 C245F probably damaging Het
Orc2 A T 1: 58,467,692 M447K probably benign Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Plxnc1 T C 10: 94,793,290 I1541V possibly damaging Het
Rapgef4 T C 2: 72,179,949 Y284H possibly damaging Het
Rnf180 C A 13: 105,181,449 probably null Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slc4a10 A G 2: 62,268,872 M625V probably benign Het
Synpo T A 18: 60,603,615 M420L probably benign Het
Tmem116 A C 5: 121,517,892 *147C probably null Het
Top2b G A 14: 16,423,779 probably null Het
Trp53bp2 T A 1: 182,455,740 C1014S probably damaging Het
Unc5b A G 10: 60,765,360 F896L probably damaging Het
Vil1 T C 1: 74,419,867 W177R probably damaging Het
Vmn2r107 A T 17: 20,375,054 Y623F probably benign Het
Vmn2r86 T C 10: 130,453,666 Y120C probably damaging Het
Wdr18 A G 10: 79,965,343 T197A possibly damaging Het
Ylpm1 A G 12: 85,029,290 M472V probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp677 A G 17: 21,397,656 Y325C probably damaging Het
Zfyve1 A G 12: 83,558,704 F407S probably damaging Het
Other mutations in Drg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03019:Drg2 APN 11 60456595 missense probably damaging 1.00
R0356:Drg2 UTSW 11 60461581 missense probably damaging 0.97
R1483:Drg2 UTSW 11 60459527 missense probably damaging 1.00
R1501:Drg2 UTSW 11 60464853 missense probably benign 0.00
R2517:Drg2 UTSW 11 60468128 missense probably damaging 0.96
R3434:Drg2 UTSW 11 60461392 nonsense probably null
R3824:Drg2 UTSW 11 60459508 missense possibly damaging 0.85
R3825:Drg2 UTSW 11 60459508 missense possibly damaging 0.85
R3898:Drg2 UTSW 11 60456634 missense probably benign
R4418:Drg2 UTSW 11 60468146 missense probably damaging 1.00
R4732:Drg2 UTSW 11 60461396 critical splice donor site probably null
R4733:Drg2 UTSW 11 60461396 critical splice donor site probably null
R4953:Drg2 UTSW 11 60459436 splice site probably benign
R5492:Drg2 UTSW 11 60461596 missense probably damaging 0.99
R7282:Drg2 UTSW 11 60454693 missense probably benign 0.30
R7417:Drg2 UTSW 11 60454680 start codon destroyed probably null 0.77
R7697:Drg2 UTSW 11 60462177 missense probably damaging 0.98
R7822:Drg2 UTSW 11 60462200 nonsense probably null
R7911:Drg2 UTSW 11 60464175 missense possibly damaging 0.83
R8094:Drg2 UTSW 11 60462270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTATTAGAGGGATGGCGAGC -3'
(R):5'- TCCAAACTGAGGTGGCTTGC -3'

Sequencing Primer
(F):5'- ATGGCGAGCTGGAAACC -3'
(R):5'- CTCTTAAAGTCAGGACACAGTGATGC -3'
Posted On2017-06-26