Incidental Mutation 'R6007:Gpr179'
ID479544
Institutional Source Beutler Lab
Gene Symbol Gpr179
Ensembl Gene ENSMUSG00000070337
Gene NameG protein-coupled receptor 179
Synonyms5330439C02Rik
MMRRC Submission 044184-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6007 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location97332109-97352077 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 97335802 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1842 (C1842*)
Ref Sequence ENSEMBL: ENSMUSP00000091474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093942]
Predicted Effect probably null
Transcript: ENSMUST00000093942
AA Change: C1842*
SMART Domains Protein: ENSMUSP00000091474
Gene: ENSMUSG00000070337
AA Change: C1842*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 28 41 N/A INTRINSIC
EGF 281 357 1.91e1 SMART
Pfam:7tm_3 391 633 3.2e-40 PFAM
low complexity region 735 759 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 959 988 N/A INTRINSIC
low complexity region 1107 1125 N/A INTRINSIC
internal_repeat_2 1156 1467 1.99e-12 PROSPERO
internal_repeat_1 1235 1674 2.85e-27 PROSPERO
internal_repeat_2 1569 1879 1.99e-12 PROSPERO
internal_repeat_1 1756 2284 2.85e-27 PROSPERO
Meta Mutation Damage Score 0.9710 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate receptor subfamily of G protein-coupled receptors. The encoded protein has an EGF-like calcium binding domain and a seven transmembrane domain in the N-terminal region of the protein. Mutations in this gene are associated with congenital stationary night blindness type 1E. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absence of b wave without retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,160,918 A9S possibly damaging Het
4930407I10Rik C G 15: 82,062,739 T279S probably benign Het
A830018L16Rik A G 1: 11,511,916 probably null Het
Abcg5 T G 17: 84,668,964 I482L probably benign Het
Adgrf5 T A 17: 43,437,571 D44E probably damaging Het
Amh A G 10: 80,805,471 N75S probably benign Het
Arl8a T C 1: 135,152,868 probably null Het
Bpifb4 T C 2: 153,942,560 Y63H possibly damaging Het
Chd5 A T 4: 152,379,421 E1449V probably null Het
Chml A G 1: 175,688,028 V109A probably benign Het
Crybg3 G T 16: 59,554,474 S2139* probably null Het
Cyp2c68 T C 19: 39,734,336 D256G probably damaging Het
Dchs2 G T 3: 83,346,227 V2315L probably damaging Het
Ddx20 T C 3: 105,683,420 I227V possibly damaging Het
Drg2 T C 11: 60,462,625 V266A possibly damaging Het
Flcn C A 11: 59,792,622 E576D probably benign Het
Fstl5 T A 3: 76,410,592 D188E probably damaging Het
Gm14496 A G 2: 181,997,530 Q471R probably benign Het
Gm43772 T C 5: 66,174,991 probably benign Het
Gpc6 C T 14: 117,951,261 H436Y probably damaging Het
Ints8 G A 4: 11,208,845 T934I possibly damaging Het
Iqsec1 G T 6: 90,660,987 C1050* probably null Het
Larp4b T C 13: 9,168,757 V510A probably benign Het
Map3k13 A T 16: 21,905,183 D305V possibly damaging Het
Mc5r A T 18: 68,339,247 I226F possibly damaging Het
Mme G A 3: 63,343,508 W323* probably null Het
Mrpl24 A G 3: 87,922,398 Y97C probably benign Het
Mslnl G A 17: 25,746,775 S541N probably benign Het
Npepl1 T C 2: 174,121,057 V412A probably benign Het
Nrg3 T A 14: 39,472,452 K117* probably null Het
Olfr1275 T C 2: 111,230,930 T288A probably benign Het
Olfr736 G T 14: 50,393,491 C245F probably damaging Het
Orc2 A T 1: 58,467,692 M447K probably benign Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Plxnc1 T C 10: 94,793,290 I1541V possibly damaging Het
Rapgef4 T C 2: 72,179,949 Y284H possibly damaging Het
Rnf180 C A 13: 105,181,449 probably null Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slc4a10 A G 2: 62,268,872 M625V probably benign Het
Synpo T A 18: 60,603,615 M420L probably benign Het
Tmem116 A C 5: 121,517,892 *147C probably null Het
Top2b G A 14: 16,423,779 probably null Het
Trp53bp2 T A 1: 182,455,740 C1014S probably damaging Het
Unc5b A G 10: 60,765,360 F896L probably damaging Het
Vil1 T C 1: 74,419,867 W177R probably damaging Het
Vmn2r107 A T 17: 20,375,054 Y623F probably benign Het
Vmn2r86 T C 10: 130,453,666 Y120C probably damaging Het
Wdr18 A G 10: 79,965,343 T197A possibly damaging Het
Ylpm1 A G 12: 85,029,290 M472V probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp677 A G 17: 21,397,656 Y325C probably damaging Het
Zfyve1 A G 12: 83,558,704 F407S probably damaging Het
Other mutations in Gpr179
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Gpr179 APN 11 97337801 missense probably damaging 0.99
IGL01152:Gpr179 APN 11 97337411 missense probably benign 0.08
IGL01402:Gpr179 APN 11 97338186 nonsense probably null
IGL01404:Gpr179 APN 11 97338186 nonsense probably null
IGL01773:Gpr179 APN 11 97341366 missense probably benign 0.05
IGL02682:Gpr179 APN 11 97351865 missense probably benign
IGL02728:Gpr179 APN 11 97337900 missense probably damaging 0.99
IGL03243:Gpr179 APN 11 97351475 missense probably benign 0.02
IGL03272:Gpr179 APN 11 97336593 missense possibly damaging 0.89
IGL03347:Gpr179 APN 11 97351838 missense probably damaging 1.00
IGL03355:Gpr179 APN 11 97337608 missense possibly damaging 0.57
PIT4280001:Gpr179 UTSW 11 97344115 missense probably damaging 1.00
PIT4366001:Gpr179 UTSW 11 97336851 missense probably benign
R0042:Gpr179 UTSW 11 97334931 missense probably benign 0.04
R0042:Gpr179 UTSW 11 97334931 missense probably benign 0.04
R0080:Gpr179 UTSW 11 97351469 missense probably benign 0.08
R0255:Gpr179 UTSW 11 97336066 missense probably benign 0.24
R0412:Gpr179 UTSW 11 97338807 missense probably damaging 1.00
R0481:Gpr179 UTSW 11 97349718 missense probably damaging 1.00
R0612:Gpr179 UTSW 11 97338438 missense possibly damaging 0.86
R0786:Gpr179 UTSW 11 97343274 missense probably damaging 1.00
R1753:Gpr179 UTSW 11 97346578 missense probably damaging 1.00
R1761:Gpr179 UTSW 11 97335106 missense probably benign 0.00
R1796:Gpr179 UTSW 11 97336556 missense possibly damaging 0.86
R1969:Gpr179 UTSW 11 97337958 missense probably benign
R2240:Gpr179 UTSW 11 97351733 missense probably damaging 1.00
R3855:Gpr179 UTSW 11 97341434 missense probably damaging 1.00
R3913:Gpr179 UTSW 11 97334765 missense probably benign 0.01
R4484:Gpr179 UTSW 11 97335711 missense probably benign 0.28
R4806:Gpr179 UTSW 11 97349784 missense possibly damaging 0.55
R4816:Gpr179 UTSW 11 97339248 missense probably damaging 0.99
R4906:Gpr179 UTSW 11 97346661 missense possibly damaging 0.87
R4945:Gpr179 UTSW 11 97349718 missense probably damaging 1.00
R5191:Gpr179 UTSW 11 97338149 missense possibly damaging 0.76
R5273:Gpr179 UTSW 11 97347430 missense probably damaging 1.00
R5317:Gpr179 UTSW 11 97337845 missense probably damaging 1.00
R5459:Gpr179 UTSW 11 97336657 missense probably benign 0.00
R5507:Gpr179 UTSW 11 97338330 missense probably damaging 1.00
R5523:Gpr179 UTSW 11 97336782 missense probably benign 0.37
R5536:Gpr179 UTSW 11 97343815 missense probably damaging 1.00
R5591:Gpr179 UTSW 11 97345755 missense probably benign 0.17
R5679:Gpr179 UTSW 11 97336745 missense probably benign 0.20
R5738:Gpr179 UTSW 11 97351406 missense probably damaging 1.00
R5829:Gpr179 UTSW 11 97335698 missense probably benign 0.11
R5836:Gpr179 UTSW 11 97339056 missense probably benign 0.03
R6047:Gpr179 UTSW 11 97338416 missense probably damaging 1.00
R6339:Gpr179 UTSW 11 97344176 missense probably damaging 1.00
R6383:Gpr179 UTSW 11 97337147 missense possibly damaging 0.88
R6674:Gpr179 UTSW 11 97347405 critical splice donor site probably null
R6712:Gpr179 UTSW 11 97336167 missense possibly damaging 0.94
R6835:Gpr179 UTSW 11 97347467 missense probably damaging 1.00
R6980:Gpr179 UTSW 11 97334858 missense probably benign 0.38
R7044:Gpr179 UTSW 11 97349790 missense probably benign 0.19
R7121:Gpr179 UTSW 11 97334730 missense probably benign 0.00
R7307:Gpr179 UTSW 11 97338846 missense probably benign 0.36
R7406:Gpr179 UTSW 11 97351594 missense probably damaging 0.99
R7467:Gpr179 UTSW 11 97335289 missense probably benign 0.02
R7477:Gpr179 UTSW 11 97335839 missense possibly damaging 0.87
R7725:Gpr179 UTSW 11 97351292 missense probably damaging 1.00
R8028:Gpr179 UTSW 11 97337801 missense probably damaging 0.99
R8165:Gpr179 UTSW 11 97351538 missense probably benign 0.12
R8262:Gpr179 UTSW 11 97336157 missense probably benign 0.00
R8674:Gpr179 UTSW 11 97335047 missense probably benign 0.00
R8695:Gpr179 UTSW 11 97336298 missense possibly damaging 0.59
R8731:Gpr179 UTSW 11 97343729 missense probably damaging 1.00
R8791:Gpr179 UTSW 11 97351913 missense probably damaging 1.00
X0065:Gpr179 UTSW 11 97347438 missense probably benign 0.08
Z1176:Gpr179 UTSW 11 97336648 missense probably benign 0.05
Z1177:Gpr179 UTSW 11 97351239 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATAGGCTGAAGTTCCGAGCTTG -3'
(R):5'- AAGCCAAGATCTGTCCCTGG -3'

Sequencing Primer
(F):5'- CATCGACAGGAACCACTTGGG -3'
(R):5'- CCAAGATCTGTCCCTGGGAATTG -3'
Posted On2017-06-26