Incidental Mutation 'R6007:Ylpm1'
ID479546
Institutional Source Beutler Lab
Gene Symbol Ylpm1
Ensembl Gene ENSMUSG00000021244
Gene NameYLP motif containing 1
SynonymsZAP, A930013E17Rik, Zap3
MMRRC Submission 044184-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6007 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location84996321-85070515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85029290 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 472 (M472V)
Ref Sequence ENSEMBL: ENSMUSP00000126347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021670] [ENSMUST00000101202] [ENSMUST00000164558] [ENSMUST00000168977]
Predicted Effect probably benign
Transcript: ENSMUST00000021670
AA Change: M930V

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021670
Gene: ENSMUSG00000021244
AA Change: M930V

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
internal_repeat_1 771 840 4.03e-5 PROSPERO
low complexity region 841 854 N/A INTRINSIC
low complexity region 966 972 N/A INTRINSIC
internal_repeat_1 1062 1124 4.03e-5 PROSPERO
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1326 1338 N/A INTRINSIC
low complexity region 1339 1353 N/A INTRINSIC
low complexity region 1408 1425 N/A INTRINSIC
coiled coil region 1447 1474 N/A INTRINSIC
low complexity region 1494 1517 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1557 N/A INTRINSIC
low complexity region 1598 1630 N/A INTRINSIC
low complexity region 1678 1694 N/A INTRINSIC
low complexity region 1705 1717 N/A INTRINSIC
low complexity region 1720 1736 N/A INTRINSIC
low complexity region 1797 1808 N/A INTRINSIC
Pfam:AAA_33 1829 1990 7.8e-11 PFAM
coiled coil region 1995 2032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101202
SMART Domains Protein: ENSMUSP00000098763
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 206 N/A INTRINSIC
low complexity region 294 335 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
low complexity region 375 388 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 491 607 N/A INTRINSIC
low complexity region 641 649 N/A INTRINSIC
low complexity region 741 764 N/A INTRINSIC
low complexity region 765 779 N/A INTRINSIC
low complexity region 783 804 N/A INTRINSIC
low complexity region 845 877 N/A INTRINSIC
low complexity region 925 941 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 967 983 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
Pfam:AAA_33 1076 1265 4.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164558
AA Change: M472V

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126347
Gene: ENSMUSG00000021244
AA Change: M472V

DomainStartEndE-ValueType
low complexity region 80 196 N/A INTRINSIC
low complexity region 230 238 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 508 514 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
low complexity region 950 967 N/A INTRINSIC
coiled coil region 989 1016 N/A INTRINSIC
low complexity region 1036 1059 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1078 1099 N/A INTRINSIC
low complexity region 1140 1172 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
low complexity region 1262 1278 N/A INTRINSIC
low complexity region 1339 1350 N/A INTRINSIC
Pfam:AAA_33 1371 1559 5.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168977
SMART Domains Protein: ENSMUSP00000128962
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 788 811 N/A INTRINSIC
low complexity region 812 826 N/A INTRINSIC
low complexity region 830 851 N/A INTRINSIC
low complexity region 892 924 N/A INTRINSIC
low complexity region 972 988 N/A INTRINSIC
low complexity region 999 1011 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:AAA_33 1123 1311 4.5e-11 PFAM
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,160,918 A9S possibly damaging Het
4930407I10Rik C G 15: 82,062,739 T279S probably benign Het
A830018L16Rik A G 1: 11,511,916 probably null Het
Abcg5 T G 17: 84,668,964 I482L probably benign Het
Adgrf5 T A 17: 43,437,571 D44E probably damaging Het
Amh A G 10: 80,805,471 N75S probably benign Het
Arl8a T C 1: 135,152,868 probably null Het
Bpifb4 T C 2: 153,942,560 Y63H possibly damaging Het
Chd5 A T 4: 152,379,421 E1449V probably null Het
Chml A G 1: 175,688,028 V109A probably benign Het
Crybg3 G T 16: 59,554,474 S2139* probably null Het
Cyp2c68 T C 19: 39,734,336 D256G probably damaging Het
Dchs2 G T 3: 83,346,227 V2315L probably damaging Het
Ddx20 T C 3: 105,683,420 I227V possibly damaging Het
Drg2 T C 11: 60,462,625 V266A possibly damaging Het
Flcn C A 11: 59,792,622 E576D probably benign Het
Fstl5 T A 3: 76,410,592 D188E probably damaging Het
Gm14496 A G 2: 181,997,530 Q471R probably benign Het
Gm43772 T C 5: 66,174,991 probably benign Het
Gpc6 C T 14: 117,951,261 H436Y probably damaging Het
Gpr179 A T 11: 97,335,802 C1842* probably null Het
Ints8 G A 4: 11,208,845 T934I possibly damaging Het
Iqsec1 G T 6: 90,660,987 C1050* probably null Het
Larp4b T C 13: 9,168,757 V510A probably benign Het
Map3k13 A T 16: 21,905,183 D305V possibly damaging Het
Mc5r A T 18: 68,339,247 I226F possibly damaging Het
Mme G A 3: 63,343,508 W323* probably null Het
Mrpl24 A G 3: 87,922,398 Y97C probably benign Het
Mslnl G A 17: 25,746,775 S541N probably benign Het
Npepl1 T C 2: 174,121,057 V412A probably benign Het
Nrg3 T A 14: 39,472,452 K117* probably null Het
Olfr1275 T C 2: 111,230,930 T288A probably benign Het
Olfr736 G T 14: 50,393,491 C245F probably damaging Het
Orc2 A T 1: 58,467,692 M447K probably benign Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Plxnc1 T C 10: 94,793,290 I1541V possibly damaging Het
Rapgef4 T C 2: 72,179,949 Y284H possibly damaging Het
Rnf180 C A 13: 105,181,449 probably null Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slc4a10 A G 2: 62,268,872 M625V probably benign Het
Synpo T A 18: 60,603,615 M420L probably benign Het
Tmem116 A C 5: 121,517,892 *147C probably null Het
Top2b G A 14: 16,423,779 probably null Het
Trp53bp2 T A 1: 182,455,740 C1014S probably damaging Het
Unc5b A G 10: 60,765,360 F896L probably damaging Het
Vil1 T C 1: 74,419,867 W177R probably damaging Het
Vmn2r107 A T 17: 20,375,054 Y623F probably benign Het
Vmn2r86 T C 10: 130,453,666 Y120C probably damaging Het
Wdr18 A G 10: 79,965,343 T197A possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp677 A G 17: 21,397,656 Y325C probably damaging Het
Zfyve1 A G 12: 83,558,704 F407S probably damaging Het
Other mutations in Ylpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ylpm1 APN 12 85028954 missense possibly damaging 0.93
IGL00809:Ylpm1 APN 12 85049194 missense probably damaging 0.99
IGL01508:Ylpm1 APN 12 85015455 missense possibly damaging 0.74
IGL02199:Ylpm1 APN 12 85034005 nonsense probably null
IGL02392:Ylpm1 APN 12 85014957 missense unknown
IGL02455:Ylpm1 APN 12 85030263 missense probably damaging 1.00
IGL02506:Ylpm1 APN 12 85049191 missense probably damaging 1.00
IGL03102:Ylpm1 APN 12 85049258 splice site probably benign
I1329:Ylpm1 UTSW 12 85040880 missense probably damaging 1.00
IGL02799:Ylpm1 UTSW 12 85044484 missense probably damaging 1.00
R0010:Ylpm1 UTSW 12 85029026 missense probably damaging 0.97
R0090:Ylpm1 UTSW 12 85029040 intron probably benign
R0149:Ylpm1 UTSW 12 85028838 missense probably damaging 0.99
R0226:Ylpm1 UTSW 12 85049737 missense probably benign 0.21
R0375:Ylpm1 UTSW 12 85014980 missense unknown
R0378:Ylpm1 UTSW 12 84997076 intron probably benign
R0507:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R0742:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R1350:Ylpm1 UTSW 12 85014082 unclassified probably benign
R1452:Ylpm1 UTSW 12 85030383 missense possibly damaging 0.94
R1500:Ylpm1 UTSW 12 85014996 missense unknown
R1837:Ylpm1 UTSW 12 85029333 missense possibly damaging 0.92
R1945:Ylpm1 UTSW 12 85015418 missense probably damaging 0.98
R1971:Ylpm1 UTSW 12 85040786 missense probably damaging 1.00
R2211:Ylpm1 UTSW 12 85044378 nonsense probably null
R2213:Ylpm1 UTSW 12 85069718 missense probably benign 0.25
R2269:Ylpm1 UTSW 12 85015050 missense unknown
R2300:Ylpm1 UTSW 12 85060319 splice site probably null
R2439:Ylpm1 UTSW 12 85014117 unclassified probably benign
R2497:Ylpm1 UTSW 12 84996761 missense probably damaging 0.98
R2890:Ylpm1 UTSW 12 85029813 missense probably damaging 0.99
R3111:Ylpm1 UTSW 12 85029371 missense probably damaging 0.98
R3436:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R3437:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R4156:Ylpm1 UTSW 12 85057403 intron probably benign
R4157:Ylpm1 UTSW 12 85057403 intron probably benign
R4959:Ylpm1 UTSW 12 85049945 missense probably damaging 1.00
R5014:Ylpm1 UTSW 12 85014749 missense unknown
R5039:Ylpm1 UTSW 12 85015493 missense probably damaging 0.98
R5039:Ylpm1 UTSW 12 85042239 missense probably damaging 1.00
R5084:Ylpm1 UTSW 12 85029321 missense probably damaging 0.99
R5325:Ylpm1 UTSW 12 85013961 unclassified probably benign
R5378:Ylpm1 UTSW 12 85030255 missense probably damaging 0.99
R5428:Ylpm1 UTSW 12 85030229 missense probably benign 0.04
R5467:Ylpm1 UTSW 12 84996859 missense unknown
R5605:Ylpm1 UTSW 12 85028853 missense probably damaging 1.00
R5614:Ylpm1 UTSW 12 85064944 intron probably benign
R5748:Ylpm1 UTSW 12 85060251 splice site probably null
R5860:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5861:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5881:Ylpm1 UTSW 12 85042125 missense probably damaging 1.00
R5909:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5912:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5915:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R6000:Ylpm1 UTSW 12 84997256 missense unknown
R6004:Ylpm1 UTSW 12 85029084 missense possibly damaging 0.78
R6053:Ylpm1 UTSW 12 84996503 missense possibly damaging 0.72
R6104:Ylpm1 UTSW 12 85029630 missense probably benign 0.00
R6197:Ylpm1 UTSW 12 85042179 missense probably damaging 1.00
R6293:Ylpm1 UTSW 12 85015277 missense unknown
R6297:Ylpm1 UTSW 12 85015277 missense unknown
R6305:Ylpm1 UTSW 12 85030545 missense probably damaging 1.00
R6379:Ylpm1 UTSW 12 85030800 missense probably damaging 1.00
R6465:Ylpm1 UTSW 12 85049802 missense probably damaging 1.00
R6608:Ylpm1 UTSW 12 85015277 missense unknown
R6609:Ylpm1 UTSW 12 85015277 missense unknown
R6737:Ylpm1 UTSW 12 85030846 missense probably damaging 0.98
R6794:Ylpm1 UTSW 12 84996881 missense unknown
R7383:Ylpm1 UTSW 12 85044468 missense possibly damaging 0.93
R7514:Ylpm1 UTSW 12 85030494 missense possibly damaging 0.94
Z1088:Ylpm1 UTSW 12 85030155 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCACAAGCAGAACCTCTTTCAG -3'
(R):5'- TTCTGAGTGGGACAAACCAAC -3'

Sequencing Primer
(F):5'- TTTCAGGAAACAAAGAGCCATTAGC -3'
(R):5'- TGGGACAAACCAACACCCAAAG -3'
Posted On2017-06-26