Mutagenetix > Incidental Mutation

Incidental Mutation 'R6007:Vmn2r107'

479558

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r107

Ensembl Gene

ENSMUSG00000056910

Gene Name

vomeronasal 2, receptor 107

Synonyms

V2r6

MMRRC Submission

044184-MU

Accession Numbers

Genbank: NM_001104569; MGI: 1316664

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R6007 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20345425-20375772 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20375054 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 623 (Y623F)

Ref Sequence

ENSEMBL: ENSMUSP00000048706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042090]

AlphaFold

E9PZJ7

Predicted Effect

probably benign
Transcript: ENSMUST00000042090
AA Change: Y623F

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000048706
Gene: ENSMUSG00000056910
AA Change: Y623F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	466	3.6e-40	PFAM
Pfam:NCD3G	509	562	5.1e-21	PFAM
Pfam:7tm_3	593	830	8e-51	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.1%
20x: 90.6%

Validation Efficiency

100% (54/54)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	G	T	6: 83,160,918	A9S	possibly damaging	Het
4930407I10Rik	C	G	15: 82,062,739	T279S	probably benign	Het
A830018L16Rik	A	G	1: 11,511,916		probably null	Het
Abcg5	T	G	17: 84,668,964	I482L	probably benign	Het
Adgrf5	T	A	17: 43,437,571	D44E	probably damaging	Het
Amh	A	G	10: 80,805,471	N75S	probably benign	Het
Arl8a	T	C	1: 135,152,868		probably null	Het
Bpifb4	T	C	2: 153,942,560	Y63H	possibly damaging	Het
Chd5	A	T	4: 152,379,421	E1449V	probably null	Het
Chml	A	G	1: 175,688,028	V109A	probably benign	Het
Crybg3	G	T	16: 59,554,474	S2139*	probably null	Het
Cyp2c68	T	C	19: 39,734,336	D256G	probably damaging	Het
Dchs2	G	T	3: 83,346,227	V2315L	probably damaging	Het
Ddx20	T	C	3: 105,683,420	I227V	possibly damaging	Het
Drg2	T	C	11: 60,462,625	V266A	possibly damaging	Het
Flcn	C	A	11: 59,792,622	E576D	probably benign	Het
Fstl5	T	A	3: 76,410,592	D188E	probably damaging	Het
Gm14496	A	G	2: 181,997,530	Q471R	probably benign	Het
Gm43772	T	C	5: 66,174,991		probably benign	Het
Gpc6	C	T	14: 117,951,261	H436Y	probably damaging	Het
Gpr179	A	T	11: 97,335,802	C1842*	probably null	Het
Ints8	G	A	4: 11,208,845	T934I	possibly damaging	Het
Iqsec1	G	T	6: 90,660,987	C1050*	probably null	Het
Larp4b	T	C	13: 9,168,757	V510A	probably benign	Het
Map3k13	A	T	16: 21,905,183	D305V	possibly damaging	Het
Mc5r	A	T	18: 68,339,247	I226F	possibly damaging	Het
Mme	G	A	3: 63,343,508	W323*	probably null	Het
Mrpl24	A	G	3: 87,922,398	Y97C	probably benign	Het
Mslnl	G	A	17: 25,746,775	S541N	probably benign	Het
Npepl1	T	C	2: 174,121,057	V412A	probably benign	Het
Nrg3	T	A	14: 39,472,452	K117*	probably null	Het
Olfr1275	T	C	2: 111,230,930	T288A	probably benign	Het
Olfr736	G	T	14: 50,393,491	C245F	probably damaging	Het
Orc2	A	T	1: 58,467,692	M447K	probably benign	Het
Phf3	A	T	1: 30,804,345	H1844Q	probably damaging	Het
Plxnc1	T	C	10: 94,793,290	I1541V	possibly damaging	Het
Rapgef4	T	C	2: 72,179,949	Y284H	possibly damaging	Het
Rnf180	C	A	13: 105,181,449		probably null	Het
Secisbp2	T	C	13: 51,665,359	I325T	probably damaging	Het
Sertad2	G	A	11: 20,647,884	G27S	probably benign	Het
Slc4a10	A	G	2: 62,268,872	M625V	probably benign	Het
Synpo	T	A	18: 60,603,615	M420L	probably benign	Het
Tmem116	A	C	5: 121,517,892	*147C	probably null	Het
Top2b	G	A	14: 16,423,779		probably null	Het
Trp53bp2	T	A	1: 182,455,740	C1014S	probably damaging	Het
Unc5b	A	G	10: 60,765,360	F896L	probably damaging	Het
Vil1	T	C	1: 74,419,867	W177R	probably damaging	Het
Vmn2r86	T	C	10: 130,453,666	Y120C	probably damaging	Het
Wdr18	A	G	10: 79,965,343	T197A	possibly damaging	Het
Ylpm1	A	G	12: 85,029,290	M472V	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp677	A	G	17: 21,397,656	Y325C	probably damaging	Het
Zfyve1	A	G	12: 83,558,704	F407S	probably damaging	Het

Other mutations in Vmn2r107

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Vmn2r107	APN	17	20375747	missense	probably damaging	0.98
IGL01768:Vmn2r107	APN	17	20345606	missense	probably benign	0.32
IGL02086:Vmn2r107	APN	17	20357800	missense	probably benign	0.00
IGL02136:Vmn2r107	APN	17	20374906	missense	probably benign	0.02
IGL02266:Vmn2r107	APN	17	20356777	missense	probably damaging	1.00
IGL02285:Vmn2r107	APN	17	20375561	missense	probably damaging	1.00
IGL02724:Vmn2r107	APN	17	20356744	missense	possibly damaging	0.49
IGL02998:Vmn2r107	APN	17	20357755	missense	probably damaging	0.99
IGL03089:Vmn2r107	APN	17	20375712	missense	probably benign	0.05
IGL03284:Vmn2r107	APN	17	20356911	missense	probably benign	0.07
IGL03307:Vmn2r107	APN	17	20356776	missense	probably benign	0.09
IGL03399:Vmn2r107	APN	17	20357958	splice site	probably benign
3-1:Vmn2r107	UTSW	17	20345504	missense	probably benign
BB006:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
BB016:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
R0285:Vmn2r107	UTSW	17	20345611	missense	probably benign	0.00
R0455:Vmn2r107	UTSW	17	20374823	splice site	probably benign
R0497:Vmn2r107	UTSW	17	20375132	missense	probably damaging	1.00
R0506:Vmn2r107	UTSW	17	20357759	missense	probably benign
R0621:Vmn2r107	UTSW	17	20374990	missense	probably benign	0.01
R0667:Vmn2r107	UTSW	17	20355654	missense	possibly damaging	0.91
R1118:Vmn2r107	UTSW	17	20356598	missense	probably benign	0.03
R1204:Vmn2r107	UTSW	17	20357769	missense	probably benign
R1237:Vmn2r107	UTSW	17	20356685	nonsense	probably null
R1485:Vmn2r107	UTSW	17	20374847	missense	possibly damaging	0.95
R1783:Vmn2r107	UTSW	17	20356513	missense	possibly damaging	0.51
R1873:Vmn2r107	UTSW	17	20345578	missense	probably benign	0.10
R1974:Vmn2r107	UTSW	17	20355617	splice site	probably null
R2009:Vmn2r107	UTSW	17	20375467	missense	probably benign	0.01
R2029:Vmn2r107	UTSW	17	20375287	missense	probably benign	0.01
R2164:Vmn2r107	UTSW	17	20375642	missense	probably damaging	1.00
R2269:Vmn2r107	UTSW	17	20375555	missense	possibly damaging	0.58
R3087:Vmn2r107	UTSW	17	20360345	missense	probably benign	0.03
R3740:Vmn2r107	UTSW	17	20374889	missense	probably benign	0.00
R3961:Vmn2r107	UTSW	17	20375455	missense	probably damaging	1.00
R4031:Vmn2r107	UTSW	17	20375221	missense	probably benign	0.00
R4270:Vmn2r107	UTSW	17	20355779	missense	probably benign
R4963:Vmn2r107	UTSW	17	20375141	missense	probably damaging	1.00
R5121:Vmn2r107	UTSW	17	20355753	missense	probably benign	0.01
R5640:Vmn2r107	UTSW	17	20375164	missense	probably damaging	1.00
R6238:Vmn2r107	UTSW	17	20345587	missense	probably benign	0.43
R6298:Vmn2r107	UTSW	17	20355782	missense	probably benign	0.00
R6467:Vmn2r107	UTSW	17	20375677	missense	probably damaging	0.99
R6726:Vmn2r107	UTSW	17	20375375	missense	probably damaging	0.96
R6782:Vmn2r107	UTSW	17	20356879	missense	probably damaging	1.00
R7299:Vmn2r107	UTSW	17	20345616	missense	probably benign	0.01
R7301:Vmn2r107	UTSW	17	20345616	missense	probably benign	0.01
R7375:Vmn2r107	UTSW	17	20355876	missense	probably benign
R7448:Vmn2r107	UTSW	17	20375732	missense	probably benign	0.00
R7495:Vmn2r107	UTSW	17	20375009	missense	possibly damaging	0.71
R7589:Vmn2r107	UTSW	17	20375372	missense	probably benign	0.05
R7594:Vmn2r107	UTSW	17	20360373	missense	probably benign	0.03
R7678:Vmn2r107	UTSW	17	20356639	missense	probably benign	0.01
R7929:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
R7974:Vmn2r107	UTSW	17	20357008	missense	probably benign	0.00
R8040:Vmn2r107	UTSW	17	20375546	missense	probably damaging	1.00
R8263:Vmn2r107	UTSW	17	20360352	missense	probably damaging	1.00
R8426:Vmn2r107	UTSW	17	20356977	missense	possibly damaging	0.91
R9175:Vmn2r107	UTSW	17	20356789	missense	possibly damaging	0.79
R9537:Vmn2r107	UTSW	17	20374887	missense	probably benign	0.00
R9642:Vmn2r107	UTSW	17	20360399	missense	probably damaging	1.00
R9711:Vmn2r107	UTSW	17	20357000	missense	probably damaging	1.00
X0022:Vmn2r107	UTSW	17	20356968	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- GTAGACCAGTGTGTGAAGTGTCC -3'
(R):5'- CCTGGAAAACTGACCTTAAAGGC -3'

Sequencing Primer
(F):5'- AGTGTCCAGAGAGTCATTATGC -3'
(R):5'- CAAGAACCACAGTGATAGCTTTGGC -3'

Posted On

2017-06-26