Incidental Mutation 'R6007:Adgrf5'
ID479561
Institutional Source Beutler Lab
Gene Symbol Adgrf5
Ensembl Gene ENSMUSG00000056492
Gene Nameadhesion G protein-coupled receptor F5
SynonymsGpr116, 8430401C09Rik
MMRRC Submission 044184-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6007 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location43360451-43459557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43437571 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 44 (D44E)
Ref Sequence ENSEMBL: ENSMUSP00000153304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113599] [ENSMUST00000225004] [ENSMUST00000225962] [ENSMUST00000226087]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113599
AA Change: D430E

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109229
Gene: ENSMUSG00000056492
AA Change: D430E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:EGF 118 161 8e-14 BLAST
Pfam:SEA 165 263 9.2e-14 PFAM
IG 276 366 1.54e-4 SMART
Blast:IG_like 374 464 2e-31 BLAST
IG 475 561 1.04e-1 SMART
low complexity region 815 823 N/A INTRINSIC
GPS 949 1004 6.49e-16 SMART
Pfam:7tm_2 1011 1264 1.2e-35 PFAM
low complexity region 1328 1347 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225004
AA Change: D44E

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225962
AA Change: D185E

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226087
AA Change: D430E

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1029 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased body weight and respiratory distress associated with pulmonary alveolar proteinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,160,918 A9S possibly damaging Het
4930407I10Rik C G 15: 82,062,739 T279S probably benign Het
A830018L16Rik A G 1: 11,511,916 probably null Het
Abcg5 T G 17: 84,668,964 I482L probably benign Het
Amh A G 10: 80,805,471 N75S probably benign Het
Arl8a T C 1: 135,152,868 probably null Het
Bpifb4 T C 2: 153,942,560 Y63H possibly damaging Het
Chd5 A T 4: 152,379,421 E1449V probably null Het
Chml A G 1: 175,688,028 V109A probably benign Het
Crybg3 G T 16: 59,554,474 S2139* probably null Het
Cyp2c68 T C 19: 39,734,336 D256G probably damaging Het
Dchs2 G T 3: 83,346,227 V2315L probably damaging Het
Ddx20 T C 3: 105,683,420 I227V possibly damaging Het
Drg2 T C 11: 60,462,625 V266A possibly damaging Het
Flcn C A 11: 59,792,622 E576D probably benign Het
Fstl5 T A 3: 76,410,592 D188E probably damaging Het
Gm14496 A G 2: 181,997,530 Q471R probably benign Het
Gm43772 T C 5: 66,174,991 probably benign Het
Gpc6 C T 14: 117,951,261 H436Y probably damaging Het
Gpr179 A T 11: 97,335,802 C1842* probably null Het
Ints8 G A 4: 11,208,845 T934I possibly damaging Het
Iqsec1 G T 6: 90,660,987 C1050* probably null Het
Larp4b T C 13: 9,168,757 V510A probably benign Het
Map3k13 A T 16: 21,905,183 D305V possibly damaging Het
Mc5r A T 18: 68,339,247 I226F possibly damaging Het
Mme G A 3: 63,343,508 W323* probably null Het
Mrpl24 A G 3: 87,922,398 Y97C probably benign Het
Mslnl G A 17: 25,746,775 S541N probably benign Het
Npepl1 T C 2: 174,121,057 V412A probably benign Het
Nrg3 T A 14: 39,472,452 K117* probably null Het
Olfr1275 T C 2: 111,230,930 T288A probably benign Het
Olfr736 G T 14: 50,393,491 C245F probably damaging Het
Orc2 A T 1: 58,467,692 M447K probably benign Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Plxnc1 T C 10: 94,793,290 I1541V possibly damaging Het
Rapgef4 T C 2: 72,179,949 Y284H possibly damaging Het
Rnf180 C A 13: 105,181,449 probably null Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slc4a10 A G 2: 62,268,872 M625V probably benign Het
Synpo T A 18: 60,603,615 M420L probably benign Het
Tmem116 A C 5: 121,517,892 *147C probably null Het
Top2b G A 14: 16,423,779 probably null Het
Trp53bp2 T A 1: 182,455,740 C1014S probably damaging Het
Unc5b A G 10: 60,765,360 F896L probably damaging Het
Vil1 T C 1: 74,419,867 W177R probably damaging Het
Vmn2r107 A T 17: 20,375,054 Y623F probably benign Het
Vmn2r86 T C 10: 130,453,666 Y120C probably damaging Het
Wdr18 A G 10: 79,965,343 T197A possibly damaging Het
Ylpm1 A G 12: 85,029,290 M472V probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp677 A G 17: 21,397,656 Y325C probably damaging Het
Zfyve1 A G 12: 83,558,704 F407S probably damaging Het
Other mutations in Adgrf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adgrf5 APN 17 43449915 missense possibly damaging 0.79
IGL00590:Adgrf5 APN 17 43453147 missense probably damaging 1.00
IGL01128:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01131:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01132:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01392:Adgrf5 APN 17 43450012 missense probably benign 0.00
IGL01475:Adgrf5 APN 17 43450354 missense probably benign 0.00
IGL01614:Adgrf5 APN 17 43424471 missense possibly damaging 0.53
IGL01654:Adgrf5 APN 17 43451170 missense possibly damaging 0.89
IGL02053:Adgrf5 APN 17 43450167 missense possibly damaging 0.47
IGL02175:Adgrf5 APN 17 43451010 missense probably damaging 1.00
IGL02416:Adgrf5 APN 17 43444980 splice site probably null
IGL02525:Adgrf5 APN 17 43449963 missense probably damaging 1.00
IGL03035:Adgrf5 APN 17 43430627 missense possibly damaging 0.80
duct_tape UTSW 17 43445115 missense probably benign 0.04
Flypaper UTSW 17 43422661 splice site probably benign
Heaped UTSW 17 43447036 missense possibly damaging 0.93
la_brea UTSW 17 43452323 critical splice donor site probably null
Motel UTSW 17 43450380 missense probably damaging 1.00
noel UTSW 17 43430612 missense probably damaging 1.00
Schmutzfinger UTSW 17 43424818 nonsense probably null
sticky UTSW 17 43437571 missense probably damaging 0.98
sweetie UTSW 17 43450983 missense probably damaging 0.96
PIT4812001:Adgrf5 UTSW 17 43450369 missense probably damaging 1.00
R0699:Adgrf5 UTSW 17 43422661 splice site probably null
R0972:Adgrf5 UTSW 17 43450983 missense probably damaging 0.96
R1521:Adgrf5 UTSW 17 43430552 missense probably benign 0.03
R1523:Adgrf5 UTSW 17 43450153 missense probably benign 0.00
R1758:Adgrf5 UTSW 17 43424593 critical splice donor site probably null
R1767:Adgrf5 UTSW 17 43450564 missense possibly damaging 0.87
R1799:Adgrf5 UTSW 17 43440067 missense probably damaging 0.98
R1800:Adgrf5 UTSW 17 43451082 missense probably damaging 1.00
R1888:Adgrf5 UTSW 17 43427005 splice site probably null
R1888:Adgrf5 UTSW 17 43427005 splice site probably null
R2057:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2058:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2059:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2410:Adgrf5 UTSW 17 43455266 missense probably benign 0.11
R2568:Adgrf5 UTSW 17 43437671 missense probably damaging 1.00
R2847:Adgrf5 UTSW 17 43422640 missense possibly damaging 0.69
R2848:Adgrf5 UTSW 17 43422640 missense possibly damaging 0.69
R3800:Adgrf5 UTSW 17 43447060 splice site probably benign
R3856:Adgrf5 UTSW 17 43447036 missense possibly damaging 0.93
R4021:Adgrf5 UTSW 17 43430714 splice site probably benign
R4075:Adgrf5 UTSW 17 43450195 missense probably damaging 1.00
R4366:Adgrf5 UTSW 17 43441969 missense probably damaging 0.99
R4409:Adgrf5 UTSW 17 43441847 missense probably damaging 1.00
R4570:Adgrf5 UTSW 17 43445115 missense probably benign 0.04
R4616:Adgrf5 UTSW 17 43452440 missense probably benign 0.38
R4623:Adgrf5 UTSW 17 43450983 missense probably benign 0.16
R4645:Adgrf5 UTSW 17 43437525 missense probably damaging 1.00
R5211:Adgrf5 UTSW 17 43422620 missense probably benign 0.32
R5268:Adgrf5 UTSW 17 43450999 missense probably damaging 1.00
R5280:Adgrf5 UTSW 17 43426334 missense probably damaging 1.00
R5326:Adgrf5 UTSW 17 43440074 missense probably damaging 0.98
R5762:Adgrf5 UTSW 17 43430695 missense probably null 0.16
R5856:Adgrf5 UTSW 17 43446120 missense probably benign 0.09
R6153:Adgrf5 UTSW 17 43451083 missense possibly damaging 0.96
R6451:Adgrf5 UTSW 17 43424818 nonsense probably null
R6535:Adgrf5 UTSW 17 43440029 missense probably benign 0.05
R6536:Adgrf5 UTSW 17 43422661 splice site probably benign
R6602:Adgrf5 UTSW 17 43450304 missense probably benign 0.32
R6882:Adgrf5 UTSW 17 43450380 missense probably damaging 1.00
R6992:Adgrf5 UTSW 17 43452323 critical splice donor site probably null
R7137:Adgrf5 UTSW 17 43450897 missense probably damaging 1.00
R7170:Adgrf5 UTSW 17 43446138 missense possibly damaging 0.92
R7313:Adgrf5 UTSW 17 43445083 missense probably benign 0.01
R7313:Adgrf5 UTSW 17 43452477 critical splice donor site probably null
R7331:Adgrf5 UTSW 17 43437593 missense probably damaging 0.99
R7346:Adgrf5 UTSW 17 43451179 missense probably damaging 1.00
R7350:Adgrf5 UTSW 17 43428444 critical splice acceptor site probably null
R7667:Adgrf5 UTSW 17 43446039 missense probably benign 0.01
R7717:Adgrf5 UTSW 17 43450753 missense probably damaging 1.00
R7731:Adgrf5 UTSW 17 43450560 missense probably damaging 1.00
R7877:Adgrf5 UTSW 17 43441838 missense possibly damaging 0.63
R7950:Adgrf5 UTSW 17 43451157 missense probably damaging 0.99
R7988:Adgrf5 UTSW 17 43439813 intron probably benign
R8188:Adgrf5 UTSW 17 43430612 missense probably damaging 1.00
R8219:Adgrf5 UTSW 17 43449859 missense probably benign 0.13
R8284:Adgrf5 UTSW 17 43455270 missense unknown
R8460:Adgrf5 UTSW 17 43439808 intron probably benign
R8504:Adgrf5 UTSW 17 43446949 missense probably benign 0.01
R8751:Adgrf5 UTSW 17 43437683 missense possibly damaging 0.80
R8852:Adgrf5 UTSW 17 43453098 missense possibly damaging 0.82
X0017:Adgrf5 UTSW 17 43427045 missense probably damaging 1.00
Z1177:Adgrf5 UTSW 17 43445053 missense probably benign 0.00
Z1191:Adgrf5 UTSW 17 43445035 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGGTAGATACCTGCCAAGTTCTAG -3'
(R):5'- ATGAGGATTCCAATCGACTGGC -3'

Sequencing Primer
(F):5'- GCCAAGTTCTAGGGCTGATTAAG -3'
(R):5'- CGACTGGCAAGTATAACATACGTCTG -3'
Posted On2017-06-26