Incidental Mutation 'R6007:Mc5r'
ID 479564
Institutional Source Beutler Lab
Gene Symbol Mc5r
Ensembl Gene ENSMUSG00000007480
Gene Name melanocortin 5 receptor
Synonyms
MMRRC Submission 044184-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R6007 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 68337603-68339711 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 68339247 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 226 (I226F)
Ref Sequence ENSEMBL: ENSMUSP00000130497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172148]
AlphaFold P41149
Predicted Effect possibly damaging
Transcript: ENSMUST00000172148
AA Change: I226F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130497
Gene: ENSMUSG00000007480
AA Change: I226F

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
Pfam:7tm_4 90 314 1.6e-10 PFAM
Pfam:7TM_GPCR_Srsx 94 357 9.8e-10 PFAM
Pfam:7tm_1 100 342 6.2e-33 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the seven-pass transmembrane G protein-coupled melanocortin receptor protein family that stimulate cAMP signal transduction. The encoded protein is a receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone and is suggested to play a role in sebum generation. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in a severe defect in water repulsion and thermoregulation due to decreased production of sebaceous lipids. Males exhibit less aggressive and more defensive behavior when placed with wildtype males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,160,918 A9S possibly damaging Het
4930407I10Rik C G 15: 82,062,739 T279S probably benign Het
A830018L16Rik A G 1: 11,511,916 probably null Het
Abcg5 T G 17: 84,668,964 I482L probably benign Het
Adgrf5 T A 17: 43,437,571 D44E probably damaging Het
Amh A G 10: 80,805,471 N75S probably benign Het
Arl8a T C 1: 135,152,868 probably null Het
Bpifb4 T C 2: 153,942,560 Y63H possibly damaging Het
Chd5 A T 4: 152,379,421 E1449V probably null Het
Chml A G 1: 175,688,028 V109A probably benign Het
Crybg3 G T 16: 59,554,474 S2139* probably null Het
Cyp2c68 T C 19: 39,734,336 D256G probably damaging Het
Dchs2 G T 3: 83,346,227 V2315L probably damaging Het
Ddx20 T C 3: 105,683,420 I227V possibly damaging Het
Drg2 T C 11: 60,462,625 V266A possibly damaging Het
Flcn C A 11: 59,792,622 E576D probably benign Het
Fstl5 T A 3: 76,410,592 D188E probably damaging Het
Gm14496 A G 2: 181,997,530 Q471R probably benign Het
Gm43772 T C 5: 66,174,991 probably benign Het
Gpc6 C T 14: 117,951,261 H436Y probably damaging Het
Gpr179 A T 11: 97,335,802 C1842* probably null Het
Ints8 G A 4: 11,208,845 T934I possibly damaging Het
Iqsec1 G T 6: 90,660,987 C1050* probably null Het
Larp4b T C 13: 9,168,757 V510A probably benign Het
Map3k13 A T 16: 21,905,183 D305V possibly damaging Het
Mme G A 3: 63,343,508 W323* probably null Het
Mrpl24 A G 3: 87,922,398 Y97C probably benign Het
Mslnl G A 17: 25,746,775 S541N probably benign Het
Npepl1 T C 2: 174,121,057 V412A probably benign Het
Nrg3 T A 14: 39,472,452 K117* probably null Het
Olfr1275 T C 2: 111,230,930 T288A probably benign Het
Olfr736 G T 14: 50,393,491 C245F probably damaging Het
Orc2 A T 1: 58,467,692 M447K probably benign Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Plxnc1 T C 10: 94,793,290 I1541V possibly damaging Het
Rapgef4 T C 2: 72,179,949 Y284H possibly damaging Het
Rnf180 C A 13: 105,181,449 probably null Het
Secisbp2 T C 13: 51,665,359 I325T probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slc4a10 A G 2: 62,268,872 M625V probably benign Het
Synpo T A 18: 60,603,615 M420L probably benign Het
Tmem116 A C 5: 121,517,892 *147C probably null Het
Top2b G A 14: 16,423,779 probably null Het
Trp53bp2 T A 1: 182,455,740 C1014S probably damaging Het
Unc5b A G 10: 60,765,360 F896L probably damaging Het
Vil1 T C 1: 74,419,867 W177R probably damaging Het
Vmn2r107 A T 17: 20,375,054 Y623F probably benign Het
Vmn2r86 T C 10: 130,453,666 Y120C probably damaging Het
Wdr18 A G 10: 79,965,343 T197A possibly damaging Het
Ylpm1 A G 12: 85,029,290 M472V probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp677 A G 17: 21,397,656 Y325C probably damaging Het
Zfyve1 A G 12: 83,558,704 F407S probably damaging Het
Other mutations in Mc5r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Mc5r APN 18 68339244 missense probably damaging 1.00
IGL02396:Mc5r APN 18 68339466 missense possibly damaging 0.88
IGL02474:Mc5r APN 18 68338839 missense probably damaging 1.00
IGL02489:Mc5r APN 18 68339526 missense probably damaging 0.99
IGL03323:Mc5r APN 18 68339215 missense probably benign 0.00
R0022:Mc5r UTSW 18 68338782 missense probably benign
R0022:Mc5r UTSW 18 68338782 missense probably benign
R0067:Mc5r UTSW 18 68339566 missense probably damaging 1.00
R0067:Mc5r UTSW 18 68339566 missense probably damaging 1.00
R0883:Mc5r UTSW 18 68339092 missense probably damaging 1.00
R1179:Mc5r UTSW 18 68338670 splice site probably null
R1789:Mc5r UTSW 18 68338670 splice site probably null
R1866:Mc5r UTSW 18 68338670 splice site probably null
R2291:Mc5r UTSW 18 68339364 missense probably damaging 1.00
R4297:Mc5r UTSW 18 68339307 missense probably benign 0.00
R4960:Mc5r UTSW 18 68338819 missense possibly damaging 0.50
R5062:Mc5r UTSW 18 68339281 missense probably damaging 1.00
R5521:Mc5r UTSW 18 68339677 missense possibly damaging 0.73
R5853:Mc5r UTSW 18 68339493 missense probably benign 0.25
R7326:Mc5r UTSW 18 68339668 missense probably damaging 1.00
R9160:Mc5r UTSW 18 68339134 missense probably damaging 1.00
R9287:Mc5r UTSW 18 68339129 missense probably damaging 1.00
R9471:Mc5r UTSW 18 68339056 missense probably damaging 1.00
R9511:Mc5r UTSW 18 68339494 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CATCGACAACGTGTTCGACTCC -3'
(R):5'- AATCCCCAGTAGCATGGTGAG -3'

Sequencing Primer
(F):5'- GACAACGTGTTCGACTCCATGATC -3'
(R):5'- GGGTAATAGCCCCCTTCATG -3'
Posted On 2017-06-26