Mutagenetix > Incidental Mutations

Incidental Mutation 'R6008:Golga1'

479570

Institutional Source

Beutler Lab

Gene Symbol

Golga1

Ensembl Gene

ENSMUSG00000026754

Gene Name

golgi autoantigen, golgin subfamily a, 1

Synonyms

0710001G09Rik, Golgi97, golgin-97, 2210418B03Rik

MMRRC Submission

044185-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.287) question?

Stock #

R6008 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

39016155-39065541 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 39047087 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 161 (V161A)

Ref Sequence

ENSEMBL: ENSMUSP00000145206 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039165] [ENSMUST00000112850] [ENSMUST00000149810] [ENSMUST00000184996]

Predicted Effect

probably benign
Transcript: ENSMUST00000039165
AA Change: V260A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000037735
Gene: ENSMUSG00000026754
AA Change: V260A

Domain	Start	End	E-Value	Type
coiled coil region	51	104	N/A	INTRINSIC
coiled coil region	126	169	N/A	INTRINSIC
coiled coil region	190	555	N/A	INTRINSIC
coiled coil region	599	647	N/A	INTRINSIC
Grip	682	728	5.68e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112850
AA Change: V235A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000108471
Gene: ENSMUSG00000026754
AA Change: V235A

Domain	Start	End	E-Value	Type
coiled coil region	53	144	N/A	INTRINSIC
coiled coil region	165	530	N/A	INTRINSIC
coiled coil region	574	622	N/A	INTRINSIC
Grip	657	703	5.68e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126520

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136261

Predicted Effect

probably benign
Transcript: ENSMUST00000149810
AA Change: V161A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000145206
Gene: ENSMUSG00000026754
AA Change: V161A

Domain	Start	End	E-Value	Type
coiled coil region	1	48	N/A	INTRINSIC
coiled coil region	70	183	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153914

Predicted Effect

probably benign
Transcript: ENSMUST00000184996
AA Change: V260A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000139001
Gene: ENSMUSG00000026754
AA Change: V260A

Domain	Start	End	E-Value	Type
coiled coil region	51	104	N/A	INTRINSIC
coiled coil region	126	169	N/A	INTRINSIC
coiled coil region	190	555	N/A	INTRINSIC
coiled coil region	599	647	N/A	INTRINSIC
Grip	682	728	5.68e-18	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.2%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein is associated with Sjogren's syndrome. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice exhibit tremors and limb grasping behavior at two months of age. A variable severity of hearing loss was also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530077C05Rik	G	A	9: 22,424,126	W13*	probably null	Het
Abcc4	A	G	14: 118,490,566	L1268P	possibly damaging	Het
Acot3	T	A	12: 84,057,086	V223E	probably damaging	Het
Afap1	T	G	5: 35,997,551	S680A	probably damaging	Het
Aox1	C	T	1: 58,077,513	A801V	probably damaging	Het
Atp8b1	G	T	18: 64,577,616	T155K	probably damaging	Het
B230118H07Rik	A	T	2: 101,583,553	M133K	possibly damaging	Het
Bard1	C	A	1: 71,030,750	V690F	possibly damaging	Het
Btnl9	C	A	11: 49,182,965		probably null	Het
C1rl	A	G	6: 124,493,188	N13S	probably benign	Het
Cad	C	A	5: 31,069,112	T1166K	probably damaging	Het
Ckap5	T	A	2: 91,562,989	M405K	probably damaging	Het
Csn1s1	T	C	5: 87,678,085		probably null	Het
Ctnna2	A	G	6: 76,915,828	L792P	probably damaging	Het
Dennd3	T	A	15: 73,567,080	V1099D	possibly damaging	Het
Dnaic2	A	G	11: 114,752,990	N482S	probably benign	Het
Dock10	T	C	1: 80,606,173	T184A	probably damaging	Het
Ear2	T	A	14: 44,103,089	L68H	probably damaging	Het
Edn3	A	G	2: 174,779,732	T149A	probably benign	Het
Erf	C	T	7: 25,245,616	V131M	probably benign	Het
Esp34	A	G	17: 38,554,227		probably benign	Het
Gm13128	C	T	4: 144,331,207	T128I	probably benign	Het
Gm14548	G	T	7: 3,894,600	H499N	probably damaging	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Gpr17	T	A	18: 31,947,477	T178S	probably benign	Het
Gsg1l2	T	A	11: 67,774,711	I35N	possibly damaging	Het
Hmgn3	T	A	9: 83,112,231	T46S	probably damaging	Het
Hydin	A	C	8: 110,599,085	I4709L	probably benign	Het
Ifna9	A	T	4: 88,592,363	L8Q	probably null	Het
Kpna4	T	C	3: 69,126,733	E125G	probably null	Het
Lrriq1	A	G	10: 103,170,464	S1267P	probably damaging	Het
Mab21l1	G	T	3: 55,783,097	C35F	possibly damaging	Het
Map3k2	A	G	18: 32,203,051	D97G	probably damaging	Het
Mdn1	T	A	4: 32,741,073	I3799N	probably damaging	Het
Mki67	G	A	7: 135,697,429	R1959C	probably damaging	Het
Mroh1	A	T	15: 76,451,357	H1400L	possibly damaging	Het
Mroh4	T	A	15: 74,625,472	K167*	probably null	Het
Mroh8	A	G	2: 157,253,064	I334T	probably benign	Het
Olfr559	T	A	7: 102,724,367	Y41F	probably damaging	Het
Phf11d	T	A	14: 59,365,449		probably benign	Het
Phf21a	C	T	2: 92,351,752	T342I	possibly damaging	Het
Plekhh3	T	C	11: 101,164,765	E483G	possibly damaging	Het
Ppp1r3b	G	A	8: 35,384,201	A65T	probably damaging	Het
Prkcq	A	G	2: 11,256,286	H383R	probably damaging	Het
Pum1	T	C	4: 130,768,847	V961A	probably damaging	Het
Scgb2b27	T	C	7: 34,012,136	E96G	probably benign	Het
Sel1l2	T	A	2: 140,244,105	E522V	probably damaging	Het
Socs4	T	G	14: 47,290,161	C184W	probably damaging	Het
Spdye4c	A	T	2: 128,596,633	I304F	probably benign	Het
Sptbn2	A	G	19: 4,739,278	I1249V	possibly damaging	Het
Sys1	T	C	2: 164,464,587	S154P	probably benign	Het
Taf6l	T	C	19: 8,778,166	Q275R	possibly damaging	Het
Tas2r107	A	G	6: 131,659,912	V58A	possibly damaging	Het
Thada	T	A	17: 84,436,634	I749F	probably damaging	Het
Tubb1	T	A	2: 174,457,774	H416Q	probably benign	Het
Vmn2r109	G	A	17: 20,540,719	T792I	probably damaging	Het
Zfp988	A	G	4: 147,331,802	Q231R	probably benign	Het
Zmynd8	T	C	2: 165,842,787	I182V	possibly damaging	Het
Zzz3	T	C	3: 152,428,151	V282A	probably benign	Het

Other mutations in Golga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Golga1	APN	2	39052973	nonsense	probably null
IGL00949:Golga1	APN	2	39041255	missense	probably damaging	0.98
IGL01133:Golga1	APN	2	39023472	missense	probably benign
IGL01592:Golga1	APN	2	39063282	missense	probably damaging	1.00
IGL01613:Golga1	APN	2	39020126	missense	probably benign	0.14
IGL01819:Golga1	APN	2	39034149	missense	probably benign	0.00
IGL01871:Golga1	APN	2	39050198	splice site	probably benign
IGL02744:Golga1	APN	2	39018474	missense	probably damaging	1.00
IGL02819:Golga1	APN	2	39039078	missense	probably null	0.97
IGL02874:Golga1	APN	2	39039092	missense	probably damaging	1.00
R0167:Golga1	UTSW	2	39047648	missense	probably benign	0.00
R0245:Golga1	UTSW	2	39035259	missense	probably benign	0.00
R0389:Golga1	UTSW	2	39018441	missense	probably damaging	1.00
R0443:Golga1	UTSW	2	39018441	missense	probably damaging	1.00
R0906:Golga1	UTSW	2	39047643	missense	probably damaging	0.99
R1508:Golga1	UTSW	2	39023249	missense	probably benign
R1901:Golga1	UTSW	2	39047780	splice site	probably null
R1964:Golga1	UTSW	2	39047087	missense	probably benign	0.00
R2228:Golga1	UTSW	2	39023171	missense	probably benign	0.02
R3734:Golga1	UTSW	2	39050170	missense	possibly damaging	0.88
R4407:Golga1	UTSW	2	39019641	unclassified	probably null
R4504:Golga1	UTSW	2	39023454	missense	probably benign	0.00
R4973:Golga1	UTSW	2	39039106	missense	probably damaging	0.99
R5049:Golga1	UTSW	2	39047735	missense	probably damaging	1.00
R5600:Golga1	UTSW	2	39020099	missense	probably damaging	1.00
R6374:Golga1	UTSW	2	39034068	missense	probably benign
R6388:Golga1	UTSW	2	39023171	missense	probably benign	0.02
R6601:Golga1	UTSW	2	39020106	missense	probably damaging	1.00
R7067:Golga1	UTSW	2	39047719	missense	probably benign	0.00
R7816:Golga1	UTSW	2	39052098	missense	probably damaging	1.00
X0025:Golga1	UTSW	2	39052062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATGTACCACCACATCTGGAAATAC -3'
(R):5'- AGCCAAGGAGCCTTTACACG -3'

Sequencing Primer
(F):5'- GGAAATACCATGTCTTCTGTTCAGC -3'
(R):5'- GCCTTTACACGGAGATAAACTTAGTG -3'

Posted On

2017-06-26