Incidental Mutation 'R6008:Ckap5'
ID479571
Institutional Source Beutler Lab
Gene Symbol Ckap5
Ensembl Gene ENSMUSG00000040549
Gene Namecytoskeleton associated protein 5
Synonyms4930432B04Rik, 3110043H24Rik, D730027C18Rik
MMRRC Submission 044185-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6008 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91526762-91620664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91562989 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 405 (M405K)
Ref Sequence ENSEMBL: ENSMUSP00000106969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046769] [ENSMUST00000099716] [ENSMUST00000111337] [ENSMUST00000111338]
Predicted Effect probably damaging
Transcript: ENSMUST00000046769
AA Change: M405K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046263
Gene: ENSMUSG00000040549
AA Change: M405K

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1981 1994 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099716
AA Change: M405K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097303
Gene: ENSMUSG00000040549
AA Change: M405K

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1909 1921 N/A INTRINSIC
low complexity region 2002 2015 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111337
AA Change: M405K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106969
Gene: ENSMUSG00000040549
AA Change: M405K

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1625 1638 N/A INTRINSIC
low complexity region 1699 1711 N/A INTRINSIC
low complexity region 1849 1861 N/A INTRINSIC
low complexity region 1942 1955 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111338
AA Change: M405K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106970
Gene: ENSMUSG00000040549
AA Change: M405K

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1909 1921 N/A INTRINSIC
low complexity region 2002 2015 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139433
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein which belongs to the TOG/XMAP215 family. The N-terminal half of this protein contains a microtubule-binding domain and the C-terminal half contains a KXGS motif for binding tubulin dimers. This protein has two distinct roles in spindle formation; it protects kinetochore microtubules from depolymerization and plays an essential role in centrosomal microtubule assembly. This protein may be necessary for the proper interaction of microtubules with the cell cortex for directional cell movement. It also plays a role in translation of the myelin basic protein (MBP) mRNA by interacting with heterogeneous nuclear ribonucleoprotein (hnRNP) A2, which associates with MBP. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik G A 9: 22,424,126 W13* probably null Het
Abcc4 A G 14: 118,490,566 L1268P possibly damaging Het
Acot3 T A 12: 84,057,086 V223E probably damaging Het
Afap1 T G 5: 35,997,551 S680A probably damaging Het
Aox1 C T 1: 58,077,513 A801V probably damaging Het
Atp8b1 G T 18: 64,577,616 T155K probably damaging Het
B230118H07Rik A T 2: 101,583,553 M133K possibly damaging Het
Bard1 C A 1: 71,030,750 V690F possibly damaging Het
Btnl9 C A 11: 49,182,965 probably null Het
C1rl A G 6: 124,493,188 N13S probably benign Het
Cad C A 5: 31,069,112 T1166K probably damaging Het
Csn1s1 T C 5: 87,678,085 probably null Het
Ctnna2 A G 6: 76,915,828 L792P probably damaging Het
Dennd3 T A 15: 73,567,080 V1099D possibly damaging Het
Dnaic2 A G 11: 114,752,990 N482S probably benign Het
Dock10 T C 1: 80,606,173 T184A probably damaging Het
Ear2 T A 14: 44,103,089 L68H probably damaging Het
Edn3 A G 2: 174,779,732 T149A probably benign Het
Erf C T 7: 25,245,616 V131M probably benign Het
Esp34 A G 17: 38,554,227 probably benign Het
Gm13128 C T 4: 144,331,207 T128I probably benign Het
Gm14548 G T 7: 3,894,600 H499N probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gpr17 T A 18: 31,947,477 T178S probably benign Het
Gsg1l2 T A 11: 67,774,711 I35N possibly damaging Het
Hmgn3 T A 9: 83,112,231 T46S probably damaging Het
Hydin A C 8: 110,599,085 I4709L probably benign Het
Ifna9 A T 4: 88,592,363 L8Q probably null Het
Kpna4 T C 3: 69,126,733 E125G probably null Het
Lrriq1 A G 10: 103,170,464 S1267P probably damaging Het
Mab21l1 G T 3: 55,783,097 C35F possibly damaging Het
Map3k2 A G 18: 32,203,051 D97G probably damaging Het
Mdn1 T A 4: 32,741,073 I3799N probably damaging Het
Mki67 G A 7: 135,697,429 R1959C probably damaging Het
Mroh1 A T 15: 76,451,357 H1400L possibly damaging Het
Mroh4 T A 15: 74,625,472 K167* probably null Het
Mroh8 A G 2: 157,253,064 I334T probably benign Het
Olfr559 T A 7: 102,724,367 Y41F probably damaging Het
Phf11d T A 14: 59,365,449 probably benign Het
Phf21a C T 2: 92,351,752 T342I possibly damaging Het
Plekhh3 T C 11: 101,164,765 E483G possibly damaging Het
Ppp1r3b G A 8: 35,384,201 A65T probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Pum1 T C 4: 130,768,847 V961A probably damaging Het
Scgb2b27 T C 7: 34,012,136 E96G probably benign Het
Sel1l2 T A 2: 140,244,105 E522V probably damaging Het
Socs4 T G 14: 47,290,161 C184W probably damaging Het
Spdye4c A T 2: 128,596,633 I304F probably benign Het
Sptbn2 A G 19: 4,739,278 I1249V possibly damaging Het
Sys1 T C 2: 164,464,587 S154P probably benign Het
Taf6l T C 19: 8,778,166 Q275R possibly damaging Het
Tas2r107 A G 6: 131,659,912 V58A possibly damaging Het
Thada T A 17: 84,436,634 I749F probably damaging Het
Tubb1 T A 2: 174,457,774 H416Q probably benign Het
Vmn2r109 G A 17: 20,540,719 T792I probably damaging Het
Zfp988 A G 4: 147,331,802 Q231R probably benign Het
Zmynd8 T C 2: 165,842,787 I182V possibly damaging Het
Zzz3 T C 3: 152,428,151 V282A probably benign Het
Other mutations in Ckap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Ckap5 APN 2 91606256 missense probably damaging 1.00
IGL00566:Ckap5 APN 2 91568627 splice site probably benign
IGL00585:Ckap5 APN 2 91619825 missense probably damaging 1.00
IGL00910:Ckap5 APN 2 91576050 missense probably benign 0.32
IGL01309:Ckap5 APN 2 91570184 missense probably damaging 0.99
IGL01411:Ckap5 APN 2 91601011 missense probably benign 0.26
IGL01654:Ckap5 APN 2 91577609 missense probably benign 0.26
IGL01684:Ckap5 APN 2 91555354 missense probably benign 0.06
IGL02031:Ckap5 APN 2 91612772 missense possibly damaging 0.85
IGL02057:Ckap5 APN 2 91600707 missense possibly damaging 0.91
IGL02101:Ckap5 APN 2 91572540 splice site probably benign
IGL02250:Ckap5 APN 2 91548901 missense probably damaging 1.00
IGL02556:Ckap5 APN 2 91594841 splice site probably benign
IGL02620:Ckap5 APN 2 91606369 missense probably benign 0.01
IGL02627:Ckap5 APN 2 91576021 missense probably damaging 1.00
IGL02693:Ckap5 APN 2 91570211 missense probably damaging 1.00
IGL02808:Ckap5 APN 2 91596514 missense probably damaging 1.00
IGL03086:Ckap5 APN 2 91570276 splice site probably benign
K7371:Ckap5 UTSW 2 91595523 splice site probably benign
R0106:Ckap5 UTSW 2 91578205 missense possibly damaging 0.90
R0106:Ckap5 UTSW 2 91615840 missense probably damaging 1.00
R0114:Ckap5 UTSW 2 91620112 missense possibly damaging 0.86
R0464:Ckap5 UTSW 2 91579513 missense probably benign 0.00
R0633:Ckap5 UTSW 2 91550743 missense probably damaging 0.96
R0723:Ckap5 UTSW 2 91555331 missense probably damaging 0.99
R1037:Ckap5 UTSW 2 91550629 missense probably benign 0.00
R1139:Ckap5 UTSW 2 91581143 missense probably benign 0.11
R1161:Ckap5 UTSW 2 91599375 missense probably null 1.00
R1183:Ckap5 UTSW 2 91586266 missense probably benign 0.01
R1660:Ckap5 UTSW 2 91562958 missense possibly damaging 0.92
R1850:Ckap5 UTSW 2 91595713 missense probably damaging 1.00
R1951:Ckap5 UTSW 2 91556492 splice site probably benign
R1968:Ckap5 UTSW 2 91586343 missense probably benign 0.10
R2004:Ckap5 UTSW 2 91607546 missense possibly damaging 0.91
R2143:Ckap5 UTSW 2 91565745 missense probably benign 0.00
R2391:Ckap5 UTSW 2 91585869 missense possibly damaging 0.66
R2435:Ckap5 UTSW 2 91581145 missense probably benign 0.01
R2438:Ckap5 UTSW 2 91595408 missense possibly damaging 0.95
R2680:Ckap5 UTSW 2 91588698 missense probably benign
R2698:Ckap5 UTSW 2 91578081 missense probably damaging 1.00
R3420:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R3422:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R3696:Ckap5 UTSW 2 91620166 missense probably benign 0.15
R3698:Ckap5 UTSW 2 91620166 missense probably benign 0.15
R3877:Ckap5 UTSW 2 91615150 missense possibly damaging 0.69
R4453:Ckap5 UTSW 2 91548845 missense probably damaging 1.00
R4604:Ckap5 UTSW 2 91578131 missense probably benign 0.00
R4605:Ckap5 UTSW 2 91576214 missense probably damaging 1.00
R4849:Ckap5 UTSW 2 91615271 missense probably damaging 1.00
R5267:Ckap5 UTSW 2 91591752 missense probably null 1.00
R5367:Ckap5 UTSW 2 91615141 missense possibly damaging 0.69
R5481:Ckap5 UTSW 2 91572447 missense possibly damaging 0.62
R5546:Ckap5 UTSW 2 91594816 missense probably damaging 1.00
R5704:Ckap5 UTSW 2 91576203 missense probably damaging 1.00
R5786:Ckap5 UTSW 2 91616296 splice site probably null
R5793:Ckap5 UTSW 2 91619835 missense possibly damaging 0.74
R5824:Ckap5 UTSW 2 91559136 missense probably benign 0.34
R5841:Ckap5 UTSW 2 91600682 missense probably benign 0.05
R5875:Ckap5 UTSW 2 91560861 missense probably benign
R5935:Ckap5 UTSW 2 91615100 missense possibly damaging 0.68
R6174:Ckap5 UTSW 2 91568219 missense probably benign 0.00
R6343:Ckap5 UTSW 2 91596474 missense possibly damaging 0.95
R6624:Ckap5 UTSW 2 91577651 missense probably benign 0.01
R6786:Ckap5 UTSW 2 91557575 missense probably benign 0.01
R6793:Ckap5 UTSW 2 91568709 missense probably damaging 1.00
R6841:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R6972:Ckap5 UTSW 2 91606313 missense probably damaging 0.98
R7044:Ckap5 UTSW 2 91577601 missense probably benign
R7111:Ckap5 UTSW 2 91607572 missense probably damaging 1.00
X0010:Ckap5 UTSW 2 91596509 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CTCAAGTGGTACAAGCCCTG -3'
(R):5'- ACAGCTACATATCTTGGGTTCAGAG -3'

Sequencing Primer
(F):5'- TGGTACAAGCCCTGCAGGAG -3'
(R):5'- CTGGTCTACAAAGTGAGCTCCAG -3'
Posted On2017-06-26