Incidental Mutation 'R6008:Spdye4c'
ID479574
Institutional Source Beutler Lab
Gene Symbol Spdye4c
Ensembl Gene ENSMUSG00000074812
Gene Namespeedy/RINGO cell cycle regulator family, member E4C
SynonymsGm355, LOC241634
MMRRC Submission 044185-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6008 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location128591209-128598464 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128596633 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 304 (I304F)
Ref Sequence ENSEMBL: ENSMUSP00000140478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144559] [ENSMUST00000155430] [ENSMUST00000178601]
Predicted Effect probably benign
Transcript: ENSMUST00000144559
AA Change: I304F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140478
Gene: ENSMUSG00000074812
AA Change: I304F

DomainStartEndE-ValueType
low complexity region 87 99 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Pfam:Spy1 204 335 1.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155430
SMART Domains Protein: ENSMUSP00000117916
Gene: ENSMUSG00000074812

DomainStartEndE-ValueType
low complexity region 87 99 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178601
AA Change: I304F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135991
Gene: ENSMUSG00000074812
AA Change: I304F

DomainStartEndE-ValueType
Pfam:Spy1 37 168 1.3e-54 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik G A 9: 22,424,126 W13* probably null Het
Abcc4 A G 14: 118,490,566 L1268P possibly damaging Het
Acot3 T A 12: 84,057,086 V223E probably damaging Het
Afap1 T G 5: 35,997,551 S680A probably damaging Het
Aox1 C T 1: 58,077,513 A801V probably damaging Het
Atp8b1 G T 18: 64,577,616 T155K probably damaging Het
B230118H07Rik A T 2: 101,583,553 M133K possibly damaging Het
Bard1 C A 1: 71,030,750 V690F possibly damaging Het
Btnl9 C A 11: 49,182,965 probably null Het
C1rl A G 6: 124,493,188 N13S probably benign Het
Cad C A 5: 31,069,112 T1166K probably damaging Het
Ckap5 T A 2: 91,562,989 M405K probably damaging Het
Csn1s1 T C 5: 87,678,085 probably null Het
Ctnna2 A G 6: 76,915,828 L792P probably damaging Het
Dennd3 T A 15: 73,567,080 V1099D possibly damaging Het
Dnaic2 A G 11: 114,752,990 N482S probably benign Het
Dock10 T C 1: 80,606,173 T184A probably damaging Het
Ear2 T A 14: 44,103,089 L68H probably damaging Het
Edn3 A G 2: 174,779,732 T149A probably benign Het
Erf C T 7: 25,245,616 V131M probably benign Het
Esp34 A G 17: 38,554,227 probably benign Het
Gm13128 C T 4: 144,331,207 T128I probably benign Het
Gm14548 G T 7: 3,894,600 H499N probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gpr17 T A 18: 31,947,477 T178S probably benign Het
Gsg1l2 T A 11: 67,774,711 I35N possibly damaging Het
Hmgn3 T A 9: 83,112,231 T46S probably damaging Het
Hydin A C 8: 110,599,085 I4709L probably benign Het
Ifna9 A T 4: 88,592,363 L8Q probably null Het
Kpna4 T C 3: 69,126,733 E125G probably null Het
Lrriq1 A G 10: 103,170,464 S1267P probably damaging Het
Mab21l1 G T 3: 55,783,097 C35F possibly damaging Het
Map3k2 A G 18: 32,203,051 D97G probably damaging Het
Mdn1 T A 4: 32,741,073 I3799N probably damaging Het
Mki67 G A 7: 135,697,429 R1959C probably damaging Het
Mroh1 A T 15: 76,451,357 H1400L possibly damaging Het
Mroh4 T A 15: 74,625,472 K167* probably null Het
Mroh8 A G 2: 157,253,064 I334T probably benign Het
Olfr559 T A 7: 102,724,367 Y41F probably damaging Het
Phf11d T A 14: 59,365,449 probably benign Het
Phf21a C T 2: 92,351,752 T342I possibly damaging Het
Plekhh3 T C 11: 101,164,765 E483G possibly damaging Het
Ppp1r3b G A 8: 35,384,201 A65T probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Pum1 T C 4: 130,768,847 V961A probably damaging Het
Scgb2b27 T C 7: 34,012,136 E96G probably benign Het
Sel1l2 T A 2: 140,244,105 E522V probably damaging Het
Socs4 T G 14: 47,290,161 C184W probably damaging Het
Sptbn2 A G 19: 4,739,278 I1249V possibly damaging Het
Sys1 T C 2: 164,464,587 S154P probably benign Het
Taf6l T C 19: 8,778,166 Q275R possibly damaging Het
Tas2r107 A G 6: 131,659,912 V58A possibly damaging Het
Thada T A 17: 84,436,634 I749F probably damaging Het
Tubb1 T A 2: 174,457,774 H416Q probably benign Het
Vmn2r109 G A 17: 20,540,719 T792I probably damaging Het
Zfp988 A G 4: 147,331,802 Q231R probably benign Het
Zmynd8 T C 2: 165,842,787 I182V possibly damaging Het
Zzz3 T C 3: 152,428,151 V282A probably benign Het
Other mutations in Spdye4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Spdye4c APN 2 128592666 missense possibly damaging 0.89
R0616:Spdye4c UTSW 2 128594212 missense possibly damaging 0.94
R1072:Spdye4c UTSW 2 128596637 missense probably benign 0.02
R1455:Spdye4c UTSW 2 128596558 missense probably damaging 1.00
R1545:Spdye4c UTSW 2 128595712 missense probably benign 0.03
R1682:Spdye4c UTSW 2 128592622 missense probably damaging 0.96
R4668:Spdye4c UTSW 2 128592353 missense possibly damaging 0.46
R4669:Spdye4c UTSW 2 128592353 missense possibly damaging 0.46
R5287:Spdye4c UTSW 2 128592640 missense possibly damaging 0.83
R5445:Spdye4c UTSW 2 128596564 nonsense probably null
R5613:Spdye4c UTSW 2 128592969 missense possibly damaging 0.72
R5629:Spdye4c UTSW 2 128596785 missense probably damaging 1.00
R5786:Spdye4c UTSW 2 128596841 makesense probably null
R5911:Spdye4c UTSW 2 128596074 nonsense probably null
R5912:Spdye4c UTSW 2 128596074 nonsense probably null
R6817:Spdye4c UTSW 2 128596510 missense probably damaging 1.00
R6856:Spdye4c UTSW 2 128596130 splice site probably null
R7402:Spdye4c UTSW 2 128592341 start codon destroyed probably benign 0.08
R7677:Spdye4c UTSW 2 128594136 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTGACTGTCACAGTTAGGG -3'
(R):5'- AGAGCTAGCCCATGCATGTG -3'

Sequencing Primer
(F):5'- CACAGTTAGGGATATGTGTTTCCCC -3'
(R):5'- ACTCACCTGGCTCAAGTGCAG -3'
Posted On2017-06-26