Incidental Mutation 'R6008:Pum1'
ID479586
Institutional Source Beutler Lab
Gene Symbol Pum1
Ensembl Gene ENSMUSG00000028580
Gene Namepumilio RNA-binding family member 1
SynonymsPumm
MMRRC Submission 044185-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.874) question?
Stock #R6008 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location130663321-130781564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130768847 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 961 (V961A)
Ref Sequence ENSEMBL: ENSMUSP00000095476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030315] [ENSMUST00000097862] [ENSMUST00000097864] [ENSMUST00000105991] [ENSMUST00000105992]
Predicted Effect probably damaging
Transcript: ENSMUST00000030315
AA Change: V964A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030315
Gene: ENSMUSG00000028580
AA Change: V964A

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 443 458 N/A INTRINSIC
low complexity region 476 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 584 615 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 643 666 N/A INTRINSIC
low complexity region 672 696 N/A INTRINSIC
low complexity region 731 741 N/A INTRINSIC
low complexity region 763 783 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Pumilio 849 884 1.75e-6 SMART
Pumilio 885 920 4.03e-6 SMART
Pumilio 921 955 5.24e-5 SMART
Pumilio 959 994 3.37e-8 SMART
Pumilio 995 1030 6.29e-8 SMART
Pumilio 1031 1066 1.04e-8 SMART
Pumilio 1067 1102 6.2e-7 SMART
Pumilio 1110 1145 8.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082550
Predicted Effect probably damaging
Transcript: ENSMUST00000097862
AA Change: V963A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095474
Gene: ENSMUSG00000028580
AA Change: V963A

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 954 5.24e-5 SMART
Pumilio 958 993 3.37e-8 SMART
Pumilio 994 1029 6.29e-8 SMART
Pumilio 1030 1065 1.04e-8 SMART
Pumilio 1066 1101 6.2e-7 SMART
Pumilio 1109 1144 8.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097864
AA Change: V961A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095476
Gene: ENSMUSG00000028580
AA Change: V961A

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 955 5.48e-8 SMART
Pumilio 956 991 3.37e-8 SMART
Pumilio 992 1027 6.29e-8 SMART
Pumilio 1028 1063 1.04e-8 SMART
Pumilio 1064 1099 6.2e-7 SMART
Pumilio 1107 1142 8.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105991
AA Change: V719A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101612
Gene: ENSMUSG00000028580
AA Change: V719A

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 233 260 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 341 372 N/A INTRINSIC
low complexity region 384 394 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
low complexity region 429 453 N/A INTRINSIC
low complexity region 488 498 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 555 573 N/A INTRINSIC
Pumilio 606 641 1.75e-6 SMART
Pumilio 642 677 4.03e-6 SMART
Pumilio 678 713 5.48e-8 SMART
Pumilio 714 749 3.37e-8 SMART
Pumilio 750 785 6.29e-8 SMART
Pumilio 786 821 1.04e-8 SMART
Pumilio 822 857 6.2e-7 SMART
Pumilio 865 900 8.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105992
AA Change: V867A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101613
Gene: ENSMUSG00000028580
AA Change: V867A

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 297 318 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
low complexity region 379 406 N/A INTRINSIC
low complexity region 431 442 N/A INTRINSIC
low complexity region 487 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 546 569 N/A INTRINSIC
low complexity region 575 599 N/A INTRINSIC
low complexity region 634 644 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
Pumilio 752 787 1.75e-6 SMART
Pumilio 788 823 4.03e-6 SMART
Pumilio 824 858 5.24e-5 SMART
Pumilio 862 897 3.37e-8 SMART
Pumilio 898 933 6.29e-8 SMART
Pumilio 934 969 1.04e-8 SMART
Pumilio 970 1005 6.2e-7 SMART
Pumilio 1013 1048 8.77e-7 SMART
Meta Mutation Damage Score 0.436 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PUF family, evolutionarily conserved RNA-binding proteins related to the Pumilio proteins of Drosophila and the fem-3 mRNA binding factor proteins of C. elegans. The encoded protein contains a sequence-specific RNA binding domain comprised of eight repeats and N- and C-terminal flanking regions, and serves as a translational regulator of specific mRNAs by binding to their 3' untranslated regions. The evolutionarily conserved function of the encoded protein in invertebrates and lower vertebrates suggests that the human protein may be involved in translational regulation of embryogenesis, and cell development and differentiation. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testes weight and size, decreased body weight, oligozoospermia, reduced male fertility, increased male germ cell apoptosis and small seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik G A 9: 22,424,126 W13* probably null Het
Abcc4 A G 14: 118,490,566 L1268P possibly damaging Het
Acot3 T A 12: 84,057,086 V223E probably damaging Het
Afap1 T G 5: 35,997,551 S680A probably damaging Het
Aox1 C T 1: 58,077,513 A801V probably damaging Het
Atp8b1 G T 18: 64,577,616 T155K probably damaging Het
B230118H07Rik A T 2: 101,583,553 M133K possibly damaging Het
Bard1 C A 1: 71,030,750 V690F possibly damaging Het
Btnl9 C A 11: 49,182,965 probably null Het
C1rl A G 6: 124,493,188 N13S probably benign Het
Cad C A 5: 31,069,112 T1166K probably damaging Het
Ckap5 T A 2: 91,562,989 M405K probably damaging Het
Csn1s1 T C 5: 87,678,085 probably null Het
Ctnna2 A G 6: 76,915,828 L792P probably damaging Het
Dennd3 T A 15: 73,567,080 V1099D possibly damaging Het
Dnaic2 A G 11: 114,752,990 N482S probably benign Het
Dock10 T C 1: 80,606,173 T184A probably damaging Het
Ear2 T A 14: 44,103,089 L68H probably damaging Het
Edn3 A G 2: 174,779,732 T149A probably benign Het
Erf C T 7: 25,245,616 V131M probably benign Het
Esp34 A G 17: 38,554,227 probably benign Het
Gm13128 C T 4: 144,331,207 T128I probably benign Het
Gm14548 G T 7: 3,894,600 H499N probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gpr17 T A 18: 31,947,477 T178S probably benign Het
Gsg1l2 T A 11: 67,774,711 I35N possibly damaging Het
Hmgn3 T A 9: 83,112,231 T46S probably damaging Het
Hydin A C 8: 110,599,085 I4709L probably benign Het
Ifna9 A T 4: 88,592,363 L8Q probably null Het
Kpna4 T C 3: 69,126,733 E125G probably null Het
Lrriq1 A G 10: 103,170,464 S1267P probably damaging Het
Mab21l1 G T 3: 55,783,097 C35F possibly damaging Het
Map3k2 A G 18: 32,203,051 D97G probably damaging Het
Mdn1 T A 4: 32,741,073 I3799N probably damaging Het
Mki67 G A 7: 135,697,429 R1959C probably damaging Het
Mroh1 A T 15: 76,451,357 H1400L possibly damaging Het
Mroh4 T A 15: 74,625,472 K167* probably null Het
Mroh8 A G 2: 157,253,064 I334T probably benign Het
Olfr559 T A 7: 102,724,367 Y41F probably damaging Het
Phf11d T A 14: 59,365,449 probably benign Het
Phf21a C T 2: 92,351,752 T342I possibly damaging Het
Plekhh3 T C 11: 101,164,765 E483G possibly damaging Het
Ppp1r3b G A 8: 35,384,201 A65T probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Scgb2b27 T C 7: 34,012,136 E96G probably benign Het
Sel1l2 T A 2: 140,244,105 E522V probably damaging Het
Socs4 T G 14: 47,290,161 C184W probably damaging Het
Spdye4c A T 2: 128,596,633 I304F probably benign Het
Sptbn2 A G 19: 4,739,278 I1249V possibly damaging Het
Sys1 T C 2: 164,464,587 S154P probably benign Het
Taf6l T C 19: 8,778,166 Q275R possibly damaging Het
Tas2r107 A G 6: 131,659,912 V58A possibly damaging Het
Thada T A 17: 84,436,634 I749F probably damaging Het
Tubb1 T A 2: 174,457,774 H416Q probably benign Het
Vmn2r109 G A 17: 20,540,719 T792I probably damaging Het
Zfp988 A G 4: 147,331,802 Q231R probably benign Het
Zmynd8 T C 2: 165,842,787 I182V possibly damaging Het
Zzz3 T C 3: 152,428,151 V282A probably benign Het
Other mutations in Pum1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Pum1 APN 4 130743789 missense probably damaging 1.00
IGL01327:Pum1 APN 4 130730543 missense probably damaging 0.97
IGL01360:Pum1 APN 4 130728170 intron probably benign
IGL02055:Pum1 APN 4 130754054 missense probably benign 0.19
IGL02713:Pum1 APN 4 130766012 missense probably damaging 1.00
IGL03401:Pum1 APN 4 130743681 splice site probably benign
LCD18:Pum1 UTSW 4 130730549 intron probably benign
R0077:Pum1 UTSW 4 130772674 missense probably benign 0.06
R0346:Pum1 UTSW 4 130779805 missense possibly damaging 0.74
R0632:Pum1 UTSW 4 130728104 missense probably benign 0.34
R0870:Pum1 UTSW 4 130768844 missense probably damaging 0.99
R1006:Pum1 UTSW 4 130771888 missense probably damaging 0.98
R1300:Pum1 UTSW 4 130765961 missense probably damaging 1.00
R1499:Pum1 UTSW 4 130719256 missense probably damaging 1.00
R1572:Pum1 UTSW 4 130718204 missense probably damaging 0.99
R1835:Pum1 UTSW 4 130701048 missense possibly damaging 0.93
R1864:Pum1 UTSW 4 130751525 missense possibly damaging 0.90
R1991:Pum1 UTSW 4 130718218 missense possibly damaging 0.93
R2068:Pum1 UTSW 4 130774434 missense probably benign 0.02
R2119:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2120:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2122:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2153:Pum1 UTSW 4 130751491 missense probably damaging 1.00
R2164:Pum1 UTSW 4 130728083 nonsense probably null
R2164:Pum1 UTSW 4 130728084 missense probably damaging 0.99
R2280:Pum1 UTSW 4 130766011 missense probably damaging 1.00
R3116:Pum1 UTSW 4 130772660 missense probably damaging 1.00
R3890:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R3891:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R3892:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R4134:Pum1 UTSW 4 130764069 missense probably damaging 1.00
R4258:Pum1 UTSW 4 130730280 missense probably damaging 1.00
R4731:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4732:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4733:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4973:Pum1 UTSW 4 130669137 missense probably benign 0.27
R5198:Pum1 UTSW 4 130779879 nonsense probably null
R5249:Pum1 UTSW 4 130762814 missense probably benign 0.07
R5478:Pum1 UTSW 4 130751484 missense possibly damaging 0.93
R5652:Pum1 UTSW 4 130764127 missense possibly damaging 0.95
R5932:Pum1 UTSW 4 130730366 missense probably benign 0.04
R6112:Pum1 UTSW 4 130730280 missense probably damaging 1.00
R6416:Pum1 UTSW 4 130728287 unclassified probably null
R6426:Pum1 UTSW 4 130753972 missense probably damaging 1.00
R6431:Pum1 UTSW 4 130774505 missense probably damaging 1.00
R7226:Pum1 UTSW 4 130771981 missense probably damaging 1.00
R7273:Pum1 UTSW 4 130751480 missense probably damaging 0.99
R7423:Pum1 UTSW 4 130774545 missense probably damaging 1.00
R7491:Pum1 UTSW 4 130719174 missense probably benign 0.08
R7526:Pum1 UTSW 4 130747026 missense probably damaging 0.99
X0024:Pum1 UTSW 4 130779790 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATGCTGTTAGTGCCTCG -3'
(R):5'- CCTGGTCACATGTTCAGGTTG -3'

Sequencing Primer
(F):5'- GGCAAGTTTGATGTCCCATC -3'
(R):5'- GTTGAAACCACTGCACATGACTG -3'
Posted On2017-06-26