Incidental Mutation 'R6008:Olfr559'
ID479598
Institutional Source Beutler Lab
Gene Symbol Olfr559
Ensembl Gene ENSMUSG00000066272
Gene Nameolfactory receptor 559
SynonymsGA_x6K02T2PBJ9-5441154-5440198, MOR11-1
MMRRC Submission 044185-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6008 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102723207-102727491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102724367 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 41 (Y41F)
Ref Sequence ENSEMBL: ENSMUSP00000151100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084816] [ENSMUST00000215657]
Predicted Effect probably damaging
Transcript: ENSMUST00000084816
AA Change: Y41F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095820
Gene: ENSMUSG00000066272
AA Change: Y41F

DomainStartEndE-ValueType
Pfam:7tm_4 37 317 1.1e-117 PFAM
Pfam:7TM_GPCR_Srsx 41 215 1e-10 PFAM
Pfam:7tm_1 47 299 3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215657
AA Change: Y41F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik G A 9: 22,424,126 W13* probably null Het
Abcc4 A G 14: 118,490,566 L1268P possibly damaging Het
Acot3 T A 12: 84,057,086 V223E probably damaging Het
Afap1 T G 5: 35,997,551 S680A probably damaging Het
Aox1 C T 1: 58,077,513 A801V probably damaging Het
Atp8b1 G T 18: 64,577,616 T155K probably damaging Het
B230118H07Rik A T 2: 101,583,553 M133K possibly damaging Het
Bard1 C A 1: 71,030,750 V690F possibly damaging Het
Btnl9 C A 11: 49,182,965 probably null Het
C1rl A G 6: 124,493,188 N13S probably benign Het
Cad C A 5: 31,069,112 T1166K probably damaging Het
Ckap5 T A 2: 91,562,989 M405K probably damaging Het
Csn1s1 T C 5: 87,678,085 probably null Het
Ctnna2 A G 6: 76,915,828 L792P probably damaging Het
Dennd3 T A 15: 73,567,080 V1099D possibly damaging Het
Dnaic2 A G 11: 114,752,990 N482S probably benign Het
Dock10 T C 1: 80,606,173 T184A probably damaging Het
Ear2 T A 14: 44,103,089 L68H probably damaging Het
Edn3 A G 2: 174,779,732 T149A probably benign Het
Erf C T 7: 25,245,616 V131M probably benign Het
Esp34 A G 17: 38,554,227 probably benign Het
Gm13128 C T 4: 144,331,207 T128I probably benign Het
Gm14548 G T 7: 3,894,600 H499N probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gpr17 T A 18: 31,947,477 T178S probably benign Het
Gsg1l2 T A 11: 67,774,711 I35N possibly damaging Het
Hmgn3 T A 9: 83,112,231 T46S probably damaging Het
Hydin A C 8: 110,599,085 I4709L probably benign Het
Ifna9 A T 4: 88,592,363 L8Q probably null Het
Kpna4 T C 3: 69,126,733 E125G probably null Het
Lrriq1 A G 10: 103,170,464 S1267P probably damaging Het
Mab21l1 G T 3: 55,783,097 C35F possibly damaging Het
Map3k2 A G 18: 32,203,051 D97G probably damaging Het
Mdn1 T A 4: 32,741,073 I3799N probably damaging Het
Mki67 G A 7: 135,697,429 R1959C probably damaging Het
Mroh1 A T 15: 76,451,357 H1400L possibly damaging Het
Mroh4 T A 15: 74,625,472 K167* probably null Het
Mroh8 A G 2: 157,253,064 I334T probably benign Het
Phf11d T A 14: 59,365,449 probably benign Het
Phf21a C T 2: 92,351,752 T342I possibly damaging Het
Plekhh3 T C 11: 101,164,765 E483G possibly damaging Het
Ppp1r3b G A 8: 35,384,201 A65T probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Pum1 T C 4: 130,768,847 V961A probably damaging Het
Scgb2b27 T C 7: 34,012,136 E96G probably benign Het
Sel1l2 T A 2: 140,244,105 E522V probably damaging Het
Socs4 T G 14: 47,290,161 C184W probably damaging Het
Spdye4c A T 2: 128,596,633 I304F probably benign Het
Sptbn2 A G 19: 4,739,278 I1249V possibly damaging Het
Sys1 T C 2: 164,464,587 S154P probably benign Het
Taf6l T C 19: 8,778,166 Q275R possibly damaging Het
Tas2r107 A G 6: 131,659,912 V58A possibly damaging Het
Thada T A 17: 84,436,634 I749F probably damaging Het
Tubb1 T A 2: 174,457,774 H416Q probably benign Het
Vmn2r109 G A 17: 20,540,719 T792I probably damaging Het
Zfp988 A G 4: 147,331,802 Q231R probably benign Het
Zmynd8 T C 2: 165,842,787 I182V possibly damaging Het
Zzz3 T C 3: 152,428,151 V282A probably benign Het
Other mutations in Olfr559
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02832:Olfr559 APN 7 102723651 missense probably benign 0.01
R0505:Olfr559 UTSW 7 102724029 missense probably damaging 0.97
R1131:Olfr559 UTSW 7 102723680 missense probably damaging 0.99
R1449:Olfr559 UTSW 7 102724190 missense probably damaging 1.00
R3788:Olfr559 UTSW 7 102723487 unclassified probably null
R3915:Olfr559 UTSW 7 102724202 missense possibly damaging 0.95
R3980:Olfr559 UTSW 7 102723752 missense probably damaging 0.98
R4647:Olfr559 UTSW 7 102724092 missense probably damaging 1.00
R5242:Olfr559 UTSW 7 102724276 missense probably benign 0.41
R5404:Olfr559 UTSW 7 102723600 missense possibly damaging 0.95
R5464:Olfr559 UTSW 7 102723917 missense possibly damaging 0.85
R5807:Olfr559 UTSW 7 102724202 missense possibly damaging 0.95
R5965:Olfr559 UTSW 7 102724260 missense probably benign 0.00
R6036:Olfr559 UTSW 7 102724485 missense probably benign
R6036:Olfr559 UTSW 7 102724485 missense probably benign
R6493:Olfr559 UTSW 7 102724080 missense possibly damaging 0.85
R6756:Olfr559 UTSW 7 102724088 missense probably benign 0.03
R7201:Olfr559 UTSW 7 102724485 missense probably benign
R7460:Olfr559 UTSW 7 102723821 missense probably benign 0.09
X0025:Olfr559 UTSW 7 102723815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCATTGAAGTCGATGGAAC -3'
(R):5'- TAGCCCATGTCTTTGGATAACTTC -3'

Sequencing Primer
(F):5'- CATTGAAGTCGATGGAACGATAGTC -3'
(R):5'- TTTACTTACGTTTCTTCAGAGACTG -3'
Posted On2017-06-26