Incidental Mutation 'R0513:Adcy10'
ID 47962
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms soluble adenylyl cyclase, Sacy, 4930431D04Rik, sAC
MMRRC Submission 038707-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.233) question?
Stock # R0513 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 165312752-165404343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 165347088 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 368 (D368E)
Ref Sequence ENSEMBL: ENSMUSP00000137959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably benign
Transcript: ENSMUST00000027852
AA Change: D368E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: D368E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111439
AA Change: D368E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: D368E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111440
AA Change: D368E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: D368E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
AA Change: D368E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: D368E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195194
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 99% (122/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,606,195 (GRCm39) T146A probably benign Het
Abcg4 A G 9: 44,192,984 (GRCm39) S121P possibly damaging Het
Actr2 T C 11: 20,030,124 (GRCm39) T212A probably damaging Het
Albfm1 A T 5: 90,725,786 (GRCm39) T333S probably benign Het
Anapc15 T C 7: 101,547,747 (GRCm39) probably benign Het
Aox4 A G 1: 58,256,678 (GRCm39) R67G probably benign Het
Aox4 A G 1: 58,286,459 (GRCm39) D697G probably damaging Het
Arhgap42 A T 9: 9,005,766 (GRCm39) S755T probably benign Het
Atm A G 9: 53,415,248 (GRCm39) V881A probably benign Het
Cdkal1 C T 13: 29,809,948 (GRCm39) probably benign Het
Cfap20dc A C 14: 8,536,609 (GRCm38) D199E probably damaging Het
Cfap61 C A 2: 145,877,215 (GRCm39) N491K possibly damaging Het
Chgb T C 2: 132,627,897 (GRCm39) probably benign Het
Chrna1 C A 2: 73,398,426 (GRCm39) probably benign Het
Chst10 A G 1: 38,904,844 (GRCm39) L283P probably damaging Het
Clca3a1 A G 3: 144,466,323 (GRCm39) probably null Het
Crppa A T 12: 36,440,467 (GRCm39) H125L probably damaging Het
Cryzl1 G T 16: 91,496,175 (GRCm39) A1E possibly damaging Het
Csnk1a1 T C 18: 61,709,618 (GRCm39) Y213H probably damaging Het
Cspg4 A G 9: 56,805,375 (GRCm39) Q2062R probably benign Het
Ctnnal1 A G 4: 56,835,348 (GRCm39) C310R probably benign Het
D630003M21Rik T C 2: 158,042,228 (GRCm39) E906G probably benign Het
D930048N14Rik T C 11: 51,545,755 (GRCm39) probably benign Het
Dag1 G A 9: 108,085,684 (GRCm39) P486S possibly damaging Het
Dgkq A G 5: 108,804,361 (GRCm39) L33P probably benign Het
Dlc1 C T 8: 37,051,164 (GRCm39) G856R probably damaging Het
Dst T A 1: 34,258,612 (GRCm39) probably benign Het
Dtl A T 1: 191,301,819 (GRCm39) Y79* probably null Het
Egfr T G 11: 16,822,855 (GRCm39) L406R probably damaging Het
Elp3 A T 14: 65,800,695 (GRCm39) probably null Het
Fbxw19 C A 9: 109,310,621 (GRCm39) probably null Het
Frs2 T C 10: 116,910,570 (GRCm39) E264G possibly damaging Het
Fscn2 G T 11: 120,252,706 (GRCm39) V58L probably damaging Het
Gm17324 G A 9: 78,356,007 (GRCm39) probably benign Het
Gm4787 A T 12: 81,425,086 (GRCm39) N357K probably benign Het
Gm9956 G T 10: 56,621,291 (GRCm39) Het
Gsg1l C T 7: 125,619,795 (GRCm39) probably null Het
Herc1 G A 9: 66,352,927 (GRCm39) V2138M possibly damaging Het
Htr2a T C 14: 74,943,764 (GRCm39) L448P probably benign Het
Ing3 C T 6: 21,970,034 (GRCm39) S255L probably damaging Het
Krt78 T C 15: 101,859,384 (GRCm39) D271G probably damaging Het
Lmbrd2 T A 15: 9,194,816 (GRCm39) L606H probably damaging Het
Lmod1 T A 1: 135,252,906 (GRCm39) N53K probably damaging Het
Lsr G C 7: 30,657,763 (GRCm39) A467G probably benign Het
Mbtd1 T A 11: 93,823,038 (GRCm39) probably null Het
Mill1 T A 7: 17,998,802 (GRCm39) Y337* probably null Het
Mlxipl A T 5: 135,166,117 (GRCm39) Q833L probably benign Het
Mon2 C T 10: 122,874,515 (GRCm39) V278M probably damaging Het
Mxra8 A C 4: 155,926,190 (GRCm39) M180L probably benign Het
Myo18a A T 11: 77,702,420 (GRCm39) probably benign Het
Myo1c T G 11: 75,556,657 (GRCm39) probably null Het
Myo1g T C 11: 6,460,203 (GRCm39) T782A probably benign Het
Ncapd3 A G 9: 26,975,401 (GRCm39) probably benign Het
Neb T C 2: 52,198,699 (GRCm39) D414G probably damaging Het
Nedd4l T A 18: 65,328,256 (GRCm39) probably benign Het
Nf2 T C 11: 4,741,185 (GRCm39) K343R possibly damaging Het
Nfasc A T 1: 132,531,584 (GRCm39) D733E possibly damaging Het
Nolc1 G A 19: 46,072,598 (GRCm39) D699N probably damaging Het
Nrbp2 C T 15: 75,960,825 (GRCm39) A45T probably benign Het
Obscn A G 11: 58,952,348 (GRCm39) V3907A possibly damaging Het
Or2b6 A T 13: 21,823,119 (GRCm39) D191E probably benign Het
Or2y6 T C 11: 52,104,576 (GRCm39) Q80R possibly damaging Het
Or8b8 A T 9: 37,809,351 (GRCm39) Y217F probably damaging Het
Pank2 C T 2: 131,124,526 (GRCm39) T290I probably damaging Het
Pbx4 T C 8: 70,317,529 (GRCm39) V171A probably benign Het
Pcgf1 G T 6: 83,057,555 (GRCm39) V75F probably damaging Het
Pik3ca T C 3: 32,515,660 (GRCm39) S778P probably damaging Het
Pld6 T C 11: 59,676,047 (GRCm39) I141M probably damaging Het
Polq T A 16: 36,914,864 (GRCm39) V2508E probably damaging Het
Prkca C G 11: 107,905,202 (GRCm39) D179H possibly damaging Het
Pspn T C 17: 57,306,720 (GRCm39) S70G probably damaging Het
Ptchd4 C T 17: 42,814,637 (GRCm39) T846I probably benign Het
Reg3g A C 6: 78,444,827 (GRCm39) Y50* probably null Het
Rev3l C T 10: 39,704,139 (GRCm39) H2062Y probably benign Het
Rsph4a C T 10: 33,788,987 (GRCm39) Q611* probably null Het
Scart1 C A 7: 139,804,873 (GRCm39) C625* probably null Het
Scgb1b20 G A 7: 33,072,739 (GRCm39) probably null Het
Sfxn5 T C 6: 85,246,955 (GRCm39) probably benign Het
Sh3tc1 T A 5: 35,857,651 (GRCm39) Q1179L possibly damaging Het
Skint11 A G 4: 114,051,762 (GRCm39) I37V probably benign Het
Slc35f5 T C 1: 125,503,906 (GRCm39) probably benign Het
Slc8a2 A C 7: 15,891,264 (GRCm39) D768A probably damaging Het
Slco6b1 A G 1: 96,924,909 (GRCm39) noncoding transcript Het
Smurf2 T A 11: 106,726,931 (GRCm39) T453S probably benign Het
Spag16 A G 1: 70,532,927 (GRCm39) probably benign Het
Spindoc G A 19: 7,351,509 (GRCm39) T205I probably benign Het
Stab1 T C 14: 30,870,902 (GRCm39) I1316V probably benign Het
Stox2 T C 8: 47,646,900 (GRCm39) R187G probably damaging Het
Tcea2 A C 2: 181,326,274 (GRCm39) T93P probably benign Het
Tenm4 T C 7: 96,544,830 (GRCm39) M2311T probably benign Het
Tmem63a A G 1: 180,788,026 (GRCm39) Q260R probably benign Het
Tnpo2 A T 8: 85,780,158 (GRCm39) H698L probably benign Het
Trim33 A G 3: 103,217,700 (GRCm39) D215G probably damaging Het
Ttc3 T A 16: 94,227,071 (GRCm39) I727N probably damaging Het
Ttn T A 2: 76,773,669 (GRCm39) K2271N probably damaging Het
Ubr2 T A 17: 47,297,705 (GRCm39) K223* probably null Het
Ubr4 A G 4: 139,144,186 (GRCm39) M1410V possibly damaging Het
Ugt2b35 T C 5: 87,151,271 (GRCm39) probably benign Het
Ulk4 T A 9: 120,981,391 (GRCm39) H880L probably benign Het
Unc80 G A 1: 66,661,633 (GRCm39) C1686Y possibly damaging Het
Upf2 T A 2: 5,962,478 (GRCm39) L60Q unknown Het
Usf2 A T 7: 30,654,161 (GRCm39) probably benign Het
Usp21 T A 1: 171,110,586 (GRCm39) probably benign Het
Usp21 T A 1: 171,110,588 (GRCm39) probably benign Het
Vmn2r118 T A 17: 55,917,970 (GRCm39) K181* probably null Het
Vmn2r124 T A 17: 18,293,991 (GRCm39) S693T possibly damaging Het
Vmn2r76 C A 7: 85,877,987 (GRCm39) G470V probably benign Het
Vps13c A C 9: 67,838,017 (GRCm39) I1856L probably benign Het
Vps50 C T 6: 3,520,210 (GRCm39) L119F probably damaging Het
Wdfy3 T A 5: 102,038,655 (GRCm39) S2012C probably damaging Het
Zfp1008 A C 13: 62,753,029 (GRCm39) V99G possibly damaging Het
Zfp142 A G 1: 74,610,714 (GRCm39) V924A probably damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zfp235 T C 7: 23,841,644 (GRCm39) S688P probably damaging Het
Zfp39 C T 11: 58,780,813 (GRCm39) V650I probably benign Het
Zfp82 A T 7: 29,756,265 (GRCm39) N272K probably damaging Het
Zfyve21 A C 12: 111,789,698 (GRCm39) D54A possibly damaging Het
Zfyve26 C T 12: 79,291,258 (GRCm39) D2116N probably damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165,379,483 (GRCm39) missense probably benign 0.45
IGL00731:Adcy10 APN 1 165,400,183 (GRCm39) missense probably benign
IGL01099:Adcy10 APN 1 165,367,411 (GRCm39) missense probably benign 0.21
IGL01464:Adcy10 APN 1 165,374,156 (GRCm39) missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165,340,737 (GRCm39) critical splice donor site probably null
IGL02002:Adcy10 APN 1 165,349,412 (GRCm39) missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165,398,189 (GRCm39) missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165,400,112 (GRCm39) missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165,386,697 (GRCm39) missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165,365,949 (GRCm39) missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165,337,977 (GRCm39) missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165,398,313 (GRCm39) missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165,395,295 (GRCm39) missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165,370,802 (GRCm39) missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165,347,087 (GRCm39) missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165,366,044 (GRCm39) nonsense probably null
Bugged UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
debye UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
malaysian UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
singaporean UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165,384,360 (GRCm39) missense probably benign 0.28
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165,400,160 (GRCm39) missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165,391,818 (GRCm39) missense probably benign 0.00
R0433:Adcy10 UTSW 1 165,379,591 (GRCm39) missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165,398,297 (GRCm39) missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165,337,959 (GRCm39) missense probably damaging 1.00
R0533:Adcy10 UTSW 1 165,391,592 (GRCm39) missense probably benign 0.05
R0550:Adcy10 UTSW 1 165,392,884 (GRCm39) missense probably benign 0.00
R0554:Adcy10 UTSW 1 165,340,699 (GRCm39) missense probably benign
R0597:Adcy10 UTSW 1 165,352,631 (GRCm39) critical splice donor site probably null
R0629:Adcy10 UTSW 1 165,370,674 (GRCm39) missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165,391,516 (GRCm39) missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165,342,949 (GRCm39) missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165,345,972 (GRCm39) missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165,352,602 (GRCm39) missense probably benign 0.02
R1690:Adcy10 UTSW 1 165,347,494 (GRCm39) missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165,330,812 (GRCm39) missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165,349,530 (GRCm39) missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165,398,377 (GRCm39) missense probably benign 0.02
R1929:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165,352,591 (GRCm39) missense probably benign 0.02
R2211:Adcy10 UTSW 1 165,345,781 (GRCm39) missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165,386,166 (GRCm39) missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165,403,296 (GRCm39) missense probably benign 0.38
R4538:Adcy10 UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
R4644:Adcy10 UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
R4649:Adcy10 UTSW 1 165,331,618 (GRCm39) missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165,334,213 (GRCm39) missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165,375,782 (GRCm39) missense probably benign
R4916:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165,391,532 (GRCm39) missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165,384,431 (GRCm39) missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165,347,069 (GRCm39) missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165,347,464 (GRCm39) missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165,340,709 (GRCm39) missense probably benign 0.43
R5692:Adcy10 UTSW 1 165,342,875 (GRCm39) missense probably benign 0.36
R5949:Adcy10 UTSW 1 165,367,386 (GRCm39) missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165,369,218 (GRCm39) missense probably benign 0.19
R6238:Adcy10 UTSW 1 165,403,297 (GRCm39) nonsense probably null
R6455:Adcy10 UTSW 1 165,345,943 (GRCm39) missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165,403,227 (GRCm39) missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165,334,204 (GRCm39) missense probably benign 0.21
R6957:Adcy10 UTSW 1 165,391,854 (GRCm39) missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165,384,485 (GRCm39) missense probably benign 0.02
R7027:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165,367,443 (GRCm39) missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165,366,091 (GRCm39) missense probably benign 0.27
R7130:Adcy10 UTSW 1 165,331,616 (GRCm39) missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165,337,939 (GRCm39) missense probably benign 0.01
R7182:Adcy10 UTSW 1 165,371,039 (GRCm39) splice site probably null
R7228:Adcy10 UTSW 1 165,337,841 (GRCm39) missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165,404,177 (GRCm39) missense unknown
R7561:Adcy10 UTSW 1 165,386,741 (GRCm39) missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165,398,340 (GRCm39) missense probably benign 0.01
R7812:Adcy10 UTSW 1 165,342,938 (GRCm39) missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165,340,737 (GRCm39) critical splice donor site probably null
R8040:Adcy10 UTSW 1 165,379,593 (GRCm39) missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165,374,118 (GRCm39) missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165,330,857 (GRCm39) missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165,337,906 (GRCm39) missense probably benign 0.34
R8812:Adcy10 UTSW 1 165,378,867 (GRCm39) missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165,345,914 (GRCm39) missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165,403,218 (GRCm39) missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165,370,679 (GRCm39) missense probably benign 0.00
R9712:Adcy10 UTSW 1 165,340,681 (GRCm39) missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165,379,678 (GRCm39) missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165,337,845 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGACAGACTCATGGACTCATGCAC -3'
(R):5'- TGCTTGAAGCCCAAACCAAGTCATC -3'

Sequencing Primer
(F):5'- gacctcacagcaacccac -3'
(R):5'- AAACCAAGTCATCCACTCTTTCTC -3'
Posted On 2013-06-12