Incidental Mutation 'R6008:Sptbn2'
ID479624
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Namespectrin beta, non-erythrocytic 2
SynonymsSpnb3
MMRRC Submission 044185-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6008 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4711208-4752353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4739278 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1249 (I1249V)
Ref Sequence ENSEMBL: ENSMUSP00000008991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]
Predicted Effect possibly damaging
Transcript: ENSMUST00000008991
AA Change: I1249V

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: I1249V

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik G A 9: 22,424,126 W13* probably null Het
Abcc4 A G 14: 118,490,566 L1268P possibly damaging Het
Acot3 T A 12: 84,057,086 V223E probably damaging Het
Afap1 T G 5: 35,997,551 S680A probably damaging Het
Aox1 C T 1: 58,077,513 A801V probably damaging Het
Atp8b1 G T 18: 64,577,616 T155K probably damaging Het
B230118H07Rik A T 2: 101,583,553 M133K possibly damaging Het
Bard1 C A 1: 71,030,750 V690F possibly damaging Het
Btnl9 C A 11: 49,182,965 probably null Het
C1rl A G 6: 124,493,188 N13S probably benign Het
Cad C A 5: 31,069,112 T1166K probably damaging Het
Ckap5 T A 2: 91,562,989 M405K probably damaging Het
Csn1s1 T C 5: 87,678,085 probably null Het
Ctnna2 A G 6: 76,915,828 L792P probably damaging Het
Dennd3 T A 15: 73,567,080 V1099D possibly damaging Het
Dnaic2 A G 11: 114,752,990 N482S probably benign Het
Dock10 T C 1: 80,606,173 T184A probably damaging Het
Ear2 T A 14: 44,103,089 L68H probably damaging Het
Edn3 A G 2: 174,779,732 T149A probably benign Het
Erf C T 7: 25,245,616 V131M probably benign Het
Esp34 A G 17: 38,554,227 probably benign Het
Gm13128 C T 4: 144,331,207 T128I probably benign Het
Gm14548 G T 7: 3,894,600 H499N probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gpr17 T A 18: 31,947,477 T178S probably benign Het
Gsg1l2 T A 11: 67,774,711 I35N possibly damaging Het
Hmgn3 T A 9: 83,112,231 T46S probably damaging Het
Hydin A C 8: 110,599,085 I4709L probably benign Het
Ifna9 A T 4: 88,592,363 L8Q probably null Het
Kpna4 T C 3: 69,126,733 E125G probably null Het
Lrriq1 A G 10: 103,170,464 S1267P probably damaging Het
Mab21l1 G T 3: 55,783,097 C35F possibly damaging Het
Map3k2 A G 18: 32,203,051 D97G probably damaging Het
Mdn1 T A 4: 32,741,073 I3799N probably damaging Het
Mki67 G A 7: 135,697,429 R1959C probably damaging Het
Mroh1 A T 15: 76,451,357 H1400L possibly damaging Het
Mroh4 T A 15: 74,625,472 K167* probably null Het
Mroh8 A G 2: 157,253,064 I334T probably benign Het
Olfr559 T A 7: 102,724,367 Y41F probably damaging Het
Phf11d T A 14: 59,365,449 probably benign Het
Phf21a C T 2: 92,351,752 T342I possibly damaging Het
Plekhh3 T C 11: 101,164,765 E483G possibly damaging Het
Ppp1r3b G A 8: 35,384,201 A65T probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Pum1 T C 4: 130,768,847 V961A probably damaging Het
Scgb2b27 T C 7: 34,012,136 E96G probably benign Het
Sel1l2 T A 2: 140,244,105 E522V probably damaging Het
Socs4 T G 14: 47,290,161 C184W probably damaging Het
Spdye4c A T 2: 128,596,633 I304F probably benign Het
Sys1 T C 2: 164,464,587 S154P probably benign Het
Taf6l T C 19: 8,778,166 Q275R possibly damaging Het
Tas2r107 A G 6: 131,659,912 V58A possibly damaging Het
Thada T A 17: 84,436,634 I749F probably damaging Het
Tubb1 T A 2: 174,457,774 H416Q probably benign Het
Vmn2r109 G A 17: 20,540,719 T792I probably damaging Het
Zfp988 A G 4: 147,331,802 Q231R probably benign Het
Zmynd8 T C 2: 165,842,787 I182V possibly damaging Het
Zzz3 T C 3: 152,428,151 V282A probably benign Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4724705 missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4725938 missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4745972 nonsense probably null
IGL01373:Sptbn2 APN 19 4745972 nonsense probably null
IGL01420:Sptbn2 APN 19 4734125 missense probably benign
IGL01456:Sptbn2 APN 19 4746749 missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4749693 missense probably benign
IGL03026:Sptbn2 APN 19 4724233 critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4732661 missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4747832 missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4745577 missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0121:Sptbn2 UTSW 19 4745293 missense probably damaging 1.00
R0127:Sptbn2 UTSW 19 4724744 missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4746942 critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4745145 missense probably benign 0.28
R0417:Sptbn2 UTSW 19 4737926 missense probably benign 0.01
R0457:Sptbn2 UTSW 19 4745938 missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4726690 missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4739986 missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4748123 nonsense probably null
R0742:Sptbn2 UTSW 19 4718983 missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4732665 missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4718976 missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4744246 missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4750242 critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4750497 missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4745964 nonsense probably null
R1820:Sptbn2 UTSW 19 4726596 missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4732541 missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4732685 missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4745299 missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4738559 missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4734138 missense probably benign 0.00
R2310:Sptbn2 UTSW 19 4718935 missense probably benign 0.19
R2888:Sptbn2 UTSW 19 4748636 missense possibly damaging 0.52
R3788:Sptbn2 UTSW 19 4745922 missense probably damaging 1.00
R4429:Sptbn2 UTSW 19 4738355 missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4732602 missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4739239 missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4732496 missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4742480 missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4748154 missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4729430 missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4738469 missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4729309 missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4729202 intron probably null
R4981:Sptbn2 UTSW 19 4751658 missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4737857 missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4724184 missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4750082 missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4718908 missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4750105 missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4725950 missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4748947 missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4724667 missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4738219 missense probably damaging 1.00
R6108:Sptbn2 UTSW 19 4731392 critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4748138 missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4724646 missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4732496 missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4742418 missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4744180 missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4747926 missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4749814 missense probably benign
R6703:Sptbn2 UTSW 19 4749815 missense probably benign
R6753:Sptbn2 UTSW 19 4747785 missense probably benign 0.01
R7007:Sptbn2 UTSW 19 4744145 missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4749460 missense probably null
R7219:Sptbn2 UTSW 19 4724173 missense probably damaging 1.00
R7285:Sptbn2 UTSW 19 4737443 missense probably benign 0.00
R7308:Sptbn2 UTSW 19 4751574 missense probably benign
R7469:Sptbn2 UTSW 19 4745118 missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4748082 missense probably benign 0.02
V7580:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTGAGCTTGCCGTACTCTC -3'
(R):5'- ATTTCCAGGCCTGCCATCTG -3'

Sequencing Primer
(F):5'- CGTACTCTCTTCCACCCAGG -3'
(R):5'- ATCTGTGGATCCTGACCCAG -3'
Posted On2017-06-26