Incidental Mutation 'R6009:Lemd1'
ID479628
Institutional Source Beutler Lab
Gene Symbol Lemd1
Ensembl Gene ENSMUSG00000079330
Gene NameLEM domain containing 1
SynonymsLEMP-1, 6430514M23Rik, 4930540I23Rik
MMRRC Submission 044186-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6009 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location132191431-132259227 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 132228252 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 11 (E11*)
Ref Sequence ENSEMBL: ENSMUSP00000140193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086544] [ENSMUST00000112357] [ENSMUST00000185436] [ENSMUST00000187339] [ENSMUST00000188169] [ENSMUST00000191418]
Predicted Effect probably benign
Transcript: ENSMUST00000086544
SMART Domains Protein: ENSMUSP00000083731
Gene: ENSMUSG00000066936

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112357
AA Change: E11*
SMART Domains Protein: ENSMUSP00000107976
Gene: ENSMUSG00000079330
AA Change: E11*

DomainStartEndE-ValueType
Pfam:LEM 3 42 9.6e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000185436
AA Change: E11*
SMART Domains Protein: ENSMUSP00000140418
Gene: ENSMUSG00000079330
AA Change: E11*

DomainStartEndE-ValueType
LEM 2 45 1.1e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000187339
AA Change: E11*
SMART Domains Protein: ENSMUSP00000139708
Gene: ENSMUSG00000079330
AA Change: E11*

DomainStartEndE-ValueType
LEM 2 45 1.1e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188169
AA Change: E11*
SMART Domains Protein: ENSMUSP00000140524
Gene: ENSMUSG00000079330
AA Change: E11*

DomainStartEndE-ValueType
LEM 2 45 1.1e-9 SMART
low complexity region 81 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189086
Predicted Effect probably null
Transcript: ENSMUST00000191418
AA Change: E11*
SMART Domains Protein: ENSMUSP00000140193
Gene: ENSMUSG00000079330
AA Change: E11*

DomainStartEndE-ValueType
LEM 2 45 1.1e-9 SMART
low complexity region 81 92 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,978,497 probably benign Het
Afap1 T C 5: 35,997,560 S683P probably damaging Het
Chid1 T A 7: 141,529,580 D131V probably damaging Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Crlf1 A C 8: 70,503,479 K403T probably damaging Het
Ctdspl2 T G 2: 121,988,838 N201K probably benign Het
Cyb561a3 G A 19: 10,586,808 V171I possibly damaging Het
Dazap1 T C 10: 80,285,304 probably benign Het
Dbf4 G T 5: 8,403,718 Q235K probably damaging Het
Dgka C T 10: 128,723,679 G471D probably damaging Het
Fam13b A T 18: 34,497,405 F100Y possibly damaging Het
Flii A T 11: 60,720,757 L376* probably null Het
Fnip1 G T 11: 54,502,271 G487V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golgb1 G T 16: 36,914,959 A1523S probably damaging Het
Gstm4 A G 3: 108,043,343 V114A possibly damaging Het
Gtf3c1 A G 7: 125,647,430 F1569S possibly damaging Het
Gtf3c5 A T 2: 28,571,165 D312E probably benign Het
Gtpbp1 G A 15: 79,712,096 V149M probably damaging Het
Hoxa7 C T 6: 52,217,387 V7M probably damaging Het
Il17f C T 1: 20,779,286 probably null Het
Ints9 T C 14: 65,008,082 V263A probably benign Het
Kansl1l C T 1: 66,735,600 C689Y probably benign Het
Kctd7 G A 5: 130,145,198 G39E probably damaging Het
Krt82 T A 15: 101,545,105 D282V probably benign Het
Maml2 A G 9: 13,620,998 T503A probably benign Het
Mief2 A G 11: 60,731,659 T352A probably benign Het
Msantd1 C A 5: 34,917,705 T37K probably benign Het
Mtus2 A G 5: 148,306,652 E94G probably damaging Het
Naaa A T 5: 92,259,581 L353Q probably benign Het
Nek5 T C 8: 22,120,822 E55G probably benign Het
Npat T C 9: 53,563,449 M847T probably damaging Het
Nus1 G A 10: 52,433,443 V268I probably benign Het
Olfr550 A G 7: 102,578,594 N33S possibly damaging Het
Parn C T 16: 13,667,564 D23N probably damaging Het
Pdgfa T C 5: 138,979,199 E176G probably damaging Het
Plcl1 T A 1: 55,696,246 F249I probably damaging Het
Plscr5 C T 9: 92,204,435 Q153* probably null Het
Polr2b T C 5: 77,320,252 I133T probably benign Het
Polr3c A G 3: 96,713,614 S463P probably damaging Het
Pprc1 A T 19: 46,071,732 I1530L probably damaging Het
Prex1 C T 2: 166,581,984 S996N probably damaging Het
Rnf169 C A 7: 99,927,123 R291S possibly damaging Het
Setd5 A G 6: 113,110,519 K127R probably damaging Het
Slc25a26 G T 6: 94,510,826 V89L probably benign Het
Slc4a10 A G 2: 62,046,690 T16A probably benign Het
Smchd1 A T 17: 71,440,956 H430Q probably damaging Het
Ttll7 A T 3: 146,934,535 D503V probably damaging Het
Vav2 A T 2: 27,271,900 probably null Het
Zfp345 A T 2: 150,472,517 C367S probably damaging Het
Zfp651 T C 9: 121,762,871 S86P possibly damaging Het
Zfp964 T A 8: 69,663,456 H235Q possibly damaging Het
Other mutations in Lemd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Lemd1 APN 1 132256709 missense probably benign 0.00
R1742:Lemd1 UTSW 1 132228298 missense probably damaging 1.00
R2212:Lemd1 UTSW 1 132228286 missense probably benign 0.11
R6014:Lemd1 UTSW 1 132256725 makesense probably null
R7163:Lemd1 UTSW 1 132256737 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TTCACCAAGGCTACCAGTGC -3'
(R):5'- CAGTGGCTTTTACTACATATGTTCC -3'

Sequencing Primer
(F):5'- CAATGAGTGCCCTAGCCCTG -3'
(R):5'- ACATATGTTCCTTCTACTTCTCTGC -3'
Posted On2017-06-26