Incidental Mutation 'R6009:Slc4a10'
ID479630
Institutional Source Beutler Lab
Gene Symbol Slc4a10
Ensembl Gene ENSMUSG00000026904
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter-like, member 10
SynonymsNCBE
MMRRC Submission 044186-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6009 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location62046462-62326730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62046690 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 16 (T16A)
Ref Sequence ENSEMBL: ENSMUSP00000108099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054484] [ENSMUST00000102735] [ENSMUST00000112480]
Predicted Effect probably benign
Transcript: ENSMUST00000054484
AA Change: T16A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000061411
Gene: ENSMUSG00000026904
AA Change: T16A

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 9e-107 PFAM
Pfam:HCO3_cotransp 445 959 1e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102735
AA Change: T16A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099796
Gene: ENSMUSG00000026904
AA Change: T16A

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 405 2e-106 PFAM
Pfam:HCO3_cotransp 445 959 2.4e-246 PFAM
transmembrane domain 967 989 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112480
AA Change: T16A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108099
Gene: ENSMUSG00000026904
AA Change: T16A

DomainStartEndE-ValueType
low complexity region 57 79 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
Pfam:Band_3_cyto 146 435 9.6e-108 PFAM
Pfam:HCO3_cotransp 476 989 1.5e-245 PFAM
transmembrane domain 997 1019 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155219
Meta Mutation Damage Score 0.0685 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein encoded by this gene was initially identified as a sodium-driven chloride bicarbonate exchanger (NCBE) though there is now evidence that its sodium/bicarbonate cotransport activity is independent of any chloride ion countertransport under physiological conditions. This gene is now classified as a member A10 of the SLC4 family of transmembrane solute carriers. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous disruption of this gene exhibit reduced brain ventricle volume, reduced neuronal excitability, impaired pH regulation of neurons, and increased threshold to induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,978,497 probably benign Het
Afap1 T C 5: 35,997,560 S683P probably damaging Het
Chid1 T A 7: 141,529,580 D131V probably damaging Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Crlf1 A C 8: 70,503,479 K403T probably damaging Het
Ctdspl2 T G 2: 121,988,838 N201K probably benign Het
Cyb561a3 G A 19: 10,586,808 V171I possibly damaging Het
Dazap1 T C 10: 80,285,304 probably benign Het
Dbf4 G T 5: 8,403,718 Q235K probably damaging Het
Dgka C T 10: 128,723,679 G471D probably damaging Het
Fam13b A T 18: 34,497,405 F100Y possibly damaging Het
Flii A T 11: 60,720,757 L376* probably null Het
Fnip1 G T 11: 54,502,271 G487V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golgb1 G T 16: 36,914,959 A1523S probably damaging Het
Gstm4 A G 3: 108,043,343 V114A possibly damaging Het
Gtf3c1 A G 7: 125,647,430 F1569S possibly damaging Het
Gtf3c5 A T 2: 28,571,165 D312E probably benign Het
Gtpbp1 G A 15: 79,712,096 V149M probably damaging Het
Hoxa7 C T 6: 52,217,387 V7M probably damaging Het
Il17f C T 1: 20,779,286 probably null Het
Ints9 T C 14: 65,008,082 V263A probably benign Het
Kansl1l C T 1: 66,735,600 C689Y probably benign Het
Kctd7 G A 5: 130,145,198 G39E probably damaging Het
Krt82 T A 15: 101,545,105 D282V probably benign Het
Lemd1 G T 1: 132,228,252 E11* probably null Het
Maml2 A G 9: 13,620,998 T503A probably benign Het
Mief2 A G 11: 60,731,659 T352A probably benign Het
Msantd1 C A 5: 34,917,705 T37K probably benign Het
Mtus2 A G 5: 148,306,652 E94G probably damaging Het
Naaa A T 5: 92,259,581 L353Q probably benign Het
Nek5 T C 8: 22,120,822 E55G probably benign Het
Npat T C 9: 53,563,449 M847T probably damaging Het
Nus1 G A 10: 52,433,443 V268I probably benign Het
Olfr550 A G 7: 102,578,594 N33S possibly damaging Het
Parn C T 16: 13,667,564 D23N probably damaging Het
Pdgfa T C 5: 138,979,199 E176G probably damaging Het
Plcl1 T A 1: 55,696,246 F249I probably damaging Het
Plscr5 C T 9: 92,204,435 Q153* probably null Het
Polr2b T C 5: 77,320,252 I133T probably benign Het
Polr3c A G 3: 96,713,614 S463P probably damaging Het
Pprc1 A T 19: 46,071,732 I1530L probably damaging Het
Prex1 C T 2: 166,581,984 S996N probably damaging Het
Rnf169 C A 7: 99,927,123 R291S possibly damaging Het
Setd5 A G 6: 113,110,519 K127R probably damaging Het
Slc25a26 G T 6: 94,510,826 V89L probably benign Het
Smchd1 A T 17: 71,440,956 H430Q probably damaging Het
Ttll7 A T 3: 146,934,535 D503V probably damaging Het
Vav2 A T 2: 27,271,900 probably null Het
Zfp345 A T 2: 150,472,517 C367S probably damaging Het
Zfp651 T C 9: 121,762,871 S86P possibly damaging Het
Zfp964 T A 8: 69,663,456 H235Q possibly damaging Het
Other mutations in Slc4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Slc4a10 APN 2 62290001 missense probably damaging 1.00
IGL00990:Slc4a10 APN 2 62286940 missense probably damaging 1.00
IGL01294:Slc4a10 APN 2 62253309 critical splice acceptor site probably null
IGL01628:Slc4a10 APN 2 62268666 missense probably damaging 1.00
IGL01773:Slc4a10 APN 2 62190757 missense probably damaging 0.97
IGL02119:Slc4a10 APN 2 62228670 missense probably damaging 1.00
IGL02125:Slc4a10 APN 2 62268171 missense probably benign 0.02
IGL02406:Slc4a10 APN 2 62190769 missense probably benign 0.37
IGL02890:Slc4a10 APN 2 62286916 missense probably damaging 1.00
IGL02959:Slc4a10 APN 2 62268143 missense probably damaging 1.00
IGL02979:Slc4a10 APN 2 62288747 missense probably null 1.00
IGL03144:Slc4a10 APN 2 62250466 missense probably benign 0.00
IGL03175:Slc4a10 APN 2 62296960 missense probably damaging 0.99
IGL03383:Slc4a10 APN 2 62267436 missense probably damaging 1.00
IGL03412:Slc4a10 APN 2 62250543 splice site probably benign
R0085:Slc4a10 UTSW 2 62244346 splice site probably benign
R0401:Slc4a10 UTSW 2 62190848 missense probably benign 0.27
R0433:Slc4a10 UTSW 2 62289983 missense probably benign 0.01
R0482:Slc4a10 UTSW 2 62297017 splice site probably benign
R0506:Slc4a10 UTSW 2 62250533 missense probably benign 0.13
R0511:Slc4a10 UTSW 2 62286862 missense probably damaging 0.97
R0590:Slc4a10 UTSW 2 62190893 splice site probably benign
R0883:Slc4a10 UTSW 2 62243398 missense probably benign 0.11
R1167:Slc4a10 UTSW 2 62228574 missense probably damaging 1.00
R1276:Slc4a10 UTSW 2 62250443 missense probably damaging 0.99
R1395:Slc4a10 UTSW 2 62313286 missense probably benign 0.00
R1455:Slc4a10 UTSW 2 62286930 missense probably damaging 1.00
R1589:Slc4a10 UTSW 2 62257462 missense probably damaging 1.00
R1677:Slc4a10 UTSW 2 62324727 missense probably benign
R1848:Slc4a10 UTSW 2 62316606 missense probably damaging 1.00
R1987:Slc4a10 UTSW 2 62268204 missense probably damaging 1.00
R1988:Slc4a10 UTSW 2 62268204 missense probably damaging 1.00
R2018:Slc4a10 UTSW 2 62234381 missense probably damaging 1.00
R2019:Slc4a10 UTSW 2 62234381 missense probably damaging 1.00
R2407:Slc4a10 UTSW 2 62313343 missense probably benign
R4067:Slc4a10 UTSW 2 62046645 start codon destroyed probably benign 0.00
R4184:Slc4a10 UTSW 2 62317442 intron probably benign
R4255:Slc4a10 UTSW 2 62281936 missense probably benign 0.10
R4282:Slc4a10 UTSW 2 62244343 splice site probably null
R4296:Slc4a10 UTSW 2 62234428 missense possibly damaging 0.80
R4361:Slc4a10 UTSW 2 62243385 missense probably benign 0.00
R4596:Slc4a10 UTSW 2 62296858 missense probably damaging 1.00
R4709:Slc4a10 UTSW 2 62257517 missense probably null 1.00
R4755:Slc4a10 UTSW 2 62296988 missense probably damaging 1.00
R4836:Slc4a10 UTSW 2 62268187 missense probably damaging 1.00
R4841:Slc4a10 UTSW 2 62257595 missense possibly damaging 0.68
R4998:Slc4a10 UTSW 2 62244439 missense probably benign 0.00
R5069:Slc4a10 UTSW 2 62267571 missense probably benign 0.06
R5223:Slc4a10 UTSW 2 62253366 missense probably damaging 1.00
R5244:Slc4a10 UTSW 2 62288725 missense probably damaging 1.00
R5386:Slc4a10 UTSW 2 62290058 missense probably damaging 1.00
R5808:Slc4a10 UTSW 2 62250472 missense probably damaging 1.00
R5999:Slc4a10 UTSW 2 62243431 missense probably benign 0.10
R6007:Slc4a10 UTSW 2 62268872 missense probably benign 0.44
R6015:Slc4a10 UTSW 2 62228702 missense probably benign 0.05
R6103:Slc4a10 UTSW 2 62234465 missense probably damaging 1.00
R6141:Slc4a10 UTSW 2 62211445 missense probably damaging 1.00
R6193:Slc4a10 UTSW 2 62243357 splice site probably null
R6217:Slc4a10 UTSW 2 62303951 missense probably benign 0.27
R6280:Slc4a10 UTSW 2 62281966 missense probably benign 0.05
R6523:Slc4a10 UTSW 2 62286961 nonsense probably null
R6643:Slc4a10 UTSW 2 62228710 missense possibly damaging 0.96
R6660:Slc4a10 UTSW 2 62250403 missense possibly damaging 0.55
R7008:Slc4a10 UTSW 2 62286922 missense probably benign 0.00
R7083:Slc4a10 UTSW 2 62234495 missense probably benign 0.03
R7223:Slc4a10 UTSW 2 62268665 missense probably damaging 0.99
R7243:Slc4a10 UTSW 2 62303862 missense probably damaging 1.00
R7449:Slc4a10 UTSW 2 62303946 missense probably benign
R7621:Slc4a10 UTSW 2 62250479 missense probably damaging 0.98
R7692:Slc4a10 UTSW 2 62303964 missense possibly damaging 0.94
R7742:Slc4a10 UTSW 2 62296850 missense probably damaging 1.00
R7905:Slc4a10 UTSW 2 62268151 missense probably damaging 1.00
R7988:Slc4a10 UTSW 2 62268151 missense probably damaging 1.00
U24488:Slc4a10 UTSW 2 62046658 missense probably benign 0.05
X0019:Slc4a10 UTSW 2 62228599 missense probably damaging 1.00
Z1088:Slc4a10 UTSW 2 62228571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGCCTCCTGCTTCAGAG -3'
(R):5'- ACATTTCATCACCATGCTGC -3'

Sequencing Primer
(F):5'- GCTTCAGAGCTACCTGATCCG -3'
(R):5'- TATGCTGTGGGAGCTATC -3'
Posted On2017-06-26