Incidental Mutation 'R6009:Gstm4'
ID479635
Institutional Source Beutler Lab
Gene Symbol Gstm4
Ensembl Gene ENSMUSG00000027890
Gene Nameglutathione S-transferase, mu 4
Synonyms1110004G14Rik, Gstb4, Gstb-4
MMRRC Submission 044186-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6009 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108040408-108044894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108043343 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 114 (V114A)
Ref Sequence ENSEMBL: ENSMUSP00000029489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029489] [ENSMUST00000106670] [ENSMUST00000178808]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029489
AA Change: V114A

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029489
Gene: ENSMUSG00000027890
AA Change: V114A

DomainStartEndE-ValueType
Pfam:GST_N 3 82 1.9e-25 PFAM
Pfam:GST_N_3 13 93 1.4e-7 PFAM
Pfam:GST_C_3 42 190 7.2e-10 PFAM
Pfam:GST_C 104 192 1.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106670
AA Change: V80A

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102281
Gene: ENSMUSG00000027890
AA Change: V80A

DomainStartEndE-ValueType
Pfam:GST_N 1 48 7e-12 PFAM
Pfam:GST_C 70 158 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178808
AA Change: V80A

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136643
Gene: ENSMUSG00000027890
AA Change: V80A

DomainStartEndE-ValueType
Pfam:GST_N 1 48 7e-12 PFAM
Pfam:GST_C 70 158 1.3e-17 PFAM
Meta Mutation Damage Score 0.3079 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. Multiple transcript variants, each encoding a distinct protein isoform, have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,978,497 probably benign Het
Afap1 T C 5: 35,997,560 S683P probably damaging Het
Chid1 T A 7: 141,529,580 D131V probably damaging Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Crlf1 A C 8: 70,503,479 K403T probably damaging Het
Ctdspl2 T G 2: 121,988,838 N201K probably benign Het
Cyb561a3 G A 19: 10,586,808 V171I possibly damaging Het
Dazap1 T C 10: 80,285,304 probably benign Het
Dbf4 G T 5: 8,403,718 Q235K probably damaging Het
Dgka C T 10: 128,723,679 G471D probably damaging Het
Fam13b A T 18: 34,497,405 F100Y possibly damaging Het
Flii A T 11: 60,720,757 L376* probably null Het
Fnip1 G T 11: 54,502,271 G487V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golgb1 G T 16: 36,914,959 A1523S probably damaging Het
Gtf3c1 A G 7: 125,647,430 F1569S possibly damaging Het
Gtf3c5 A T 2: 28,571,165 D312E probably benign Het
Gtpbp1 G A 15: 79,712,096 V149M probably damaging Het
Hoxa7 C T 6: 52,217,387 V7M probably damaging Het
Il17f C T 1: 20,779,286 probably null Het
Ints9 T C 14: 65,008,082 V263A probably benign Het
Kansl1l C T 1: 66,735,600 C689Y probably benign Het
Kctd7 G A 5: 130,145,198 G39E probably damaging Het
Krt82 T A 15: 101,545,105 D282V probably benign Het
Lemd1 G T 1: 132,228,252 E11* probably null Het
Maml2 A G 9: 13,620,998 T503A probably benign Het
Mief2 A G 11: 60,731,659 T352A probably benign Het
Msantd1 C A 5: 34,917,705 T37K probably benign Het
Mtus2 A G 5: 148,306,652 E94G probably damaging Het
Naaa A T 5: 92,259,581 L353Q probably benign Het
Nek5 T C 8: 22,120,822 E55G probably benign Het
Npat T C 9: 53,563,449 M847T probably damaging Het
Nus1 G A 10: 52,433,443 V268I probably benign Het
Olfr550 A G 7: 102,578,594 N33S possibly damaging Het
Parn C T 16: 13,667,564 D23N probably damaging Het
Pdgfa T C 5: 138,979,199 E176G probably damaging Het
Plcl1 T A 1: 55,696,246 F249I probably damaging Het
Plscr5 C T 9: 92,204,435 Q153* probably null Het
Polr2b T C 5: 77,320,252 I133T probably benign Het
Polr3c A G 3: 96,713,614 S463P probably damaging Het
Pprc1 A T 19: 46,071,732 I1530L probably damaging Het
Prex1 C T 2: 166,581,984 S996N probably damaging Het
Rnf169 C A 7: 99,927,123 R291S possibly damaging Het
Setd5 A G 6: 113,110,519 K127R probably damaging Het
Slc25a26 G T 6: 94,510,826 V89L probably benign Het
Slc4a10 A G 2: 62,046,690 T16A probably benign Het
Smchd1 A T 17: 71,440,956 H430Q probably damaging Het
Ttll7 A T 3: 146,934,535 D503V probably damaging Het
Vav2 A T 2: 27,271,900 probably null Het
Zfp345 A T 2: 150,472,517 C367S probably damaging Het
Zfp651 T C 9: 121,762,871 S86P possibly damaging Het
Zfp964 T A 8: 69,663,456 H235Q possibly damaging Het
Other mutations in Gstm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03032:Gstm4 APN 3 108043947 missense probably damaging 0.99
R0533:Gstm4 UTSW 3 108043525 missense probably benign 0.02
R1799:Gstm4 UTSW 3 108043558 missense probably damaging 1.00
R1907:Gstm4 UTSW 3 108041277 missense probably benign 0.00
R4413:Gstm4 UTSW 3 108043328 missense possibly damaging 0.92
R4451:Gstm4 UTSW 3 108043975 intron probably null
R6992:Gstm4 UTSW 3 108044665 missense possibly damaging 0.58
R7347:Gstm4 UTSW 3 108042373 missense probably benign 0.25
R7909:Gstm4 UTSW 3 108043416 missense probably benign 0.12
R7990:Gstm4 UTSW 3 108043416 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GGACAGCTGATGACAACACATG -3'
(R):5'- AAGATCACGCAGAGCAATGC -3'

Sequencing Primer
(F):5'- TGATGACAACACATGAAACATCCTGG -3'
(R):5'- GCAGAGCAATGCCATCCTG -3'
Posted On2017-06-26