Incidental Mutation 'R6009:Ttll7'
ID479636
Institutional Source Beutler Lab
Gene Symbol Ttll7
Ensembl Gene ENSMUSG00000036745
Gene Nametubulin tyrosine ligase-like family, member 7
Synonyms1110049N09Rik, 4921517B04Rik
MMRRC Submission 044186-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.454) question?
Stock #R6009 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location146852367-146984009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 146934535 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 503 (D503V)
Ref Sequence ENSEMBL: ENSMUSP00000043753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037942] [ENSMUST00000106134] [ENSMUST00000170055]
Predicted Effect probably damaging
Transcript: ENSMUST00000037942
AA Change: D503V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038090
SMART Domains Protein: ENSMUSP00000037875
Gene: ENSMUSG00000036745

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106134
AA Change: D503V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101740
Gene: ENSMUSG00000036745
AA Change: D503V

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 7.2e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170055
AA Change: D503V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129369
Gene: ENSMUSG00000036745
AA Change: D503V

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 5.9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Meta Mutation Damage Score 0.1454 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,978,497 probably benign Het
Afap1 T C 5: 35,997,560 S683P probably damaging Het
Chid1 T A 7: 141,529,580 D131V probably damaging Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Crlf1 A C 8: 70,503,479 K403T probably damaging Het
Ctdspl2 T G 2: 121,988,838 N201K probably benign Het
Cyb561a3 G A 19: 10,586,808 V171I possibly damaging Het
Dazap1 T C 10: 80,285,304 probably benign Het
Dbf4 G T 5: 8,403,718 Q235K probably damaging Het
Dgka C T 10: 128,723,679 G471D probably damaging Het
Fam13b A T 18: 34,497,405 F100Y possibly damaging Het
Flii A T 11: 60,720,757 L376* probably null Het
Fnip1 G T 11: 54,502,271 G487V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golgb1 G T 16: 36,914,959 A1523S probably damaging Het
Gstm4 A G 3: 108,043,343 V114A possibly damaging Het
Gtf3c1 A G 7: 125,647,430 F1569S possibly damaging Het
Gtf3c5 A T 2: 28,571,165 D312E probably benign Het
Gtpbp1 G A 15: 79,712,096 V149M probably damaging Het
Hoxa7 C T 6: 52,217,387 V7M probably damaging Het
Il17f C T 1: 20,779,286 probably null Het
Ints9 T C 14: 65,008,082 V263A probably benign Het
Kansl1l C T 1: 66,735,600 C689Y probably benign Het
Kctd7 G A 5: 130,145,198 G39E probably damaging Het
Krt82 T A 15: 101,545,105 D282V probably benign Het
Lemd1 G T 1: 132,228,252 E11* probably null Het
Maml2 A G 9: 13,620,998 T503A probably benign Het
Mief2 A G 11: 60,731,659 T352A probably benign Het
Msantd1 C A 5: 34,917,705 T37K probably benign Het
Mtus2 A G 5: 148,306,652 E94G probably damaging Het
Naaa A T 5: 92,259,581 L353Q probably benign Het
Nek5 T C 8: 22,120,822 E55G probably benign Het
Npat T C 9: 53,563,449 M847T probably damaging Het
Nus1 G A 10: 52,433,443 V268I probably benign Het
Olfr550 A G 7: 102,578,594 N33S possibly damaging Het
Parn C T 16: 13,667,564 D23N probably damaging Het
Pdgfa T C 5: 138,979,199 E176G probably damaging Het
Plcl1 T A 1: 55,696,246 F249I probably damaging Het
Plscr5 C T 9: 92,204,435 Q153* probably null Het
Polr2b T C 5: 77,320,252 I133T probably benign Het
Polr3c A G 3: 96,713,614 S463P probably damaging Het
Pprc1 A T 19: 46,071,732 I1530L probably damaging Het
Prex1 C T 2: 166,581,984 S996N probably damaging Het
Rnf169 C A 7: 99,927,123 R291S possibly damaging Het
Setd5 A G 6: 113,110,519 K127R probably damaging Het
Slc25a26 G T 6: 94,510,826 V89L probably benign Het
Slc4a10 A G 2: 62,046,690 T16A probably benign Het
Smchd1 A T 17: 71,440,956 H430Q probably damaging Het
Vav2 A T 2: 27,271,900 probably null Het
Zfp345 A T 2: 150,472,517 C367S probably damaging Het
Zfp651 T C 9: 121,762,871 S86P possibly damaging Het
Zfp964 T A 8: 69,663,456 H235Q possibly damaging Het
Other mutations in Ttll7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ttll7 APN 3 146909582 missense possibly damaging 0.72
IGL01353:Ttll7 APN 3 146961719 missense probably damaging 1.00
IGL01415:Ttll7 APN 3 146909599 missense possibly damaging 0.90
IGL01843:Ttll7 APN 3 146940021 missense possibly damaging 0.93
IGL03101:Ttll7 APN 3 146896690 missense possibly damaging 0.82
IGL03378:Ttll7 APN 3 146909653 missense probably benign 0.06
P0038:Ttll7 UTSW 3 146945184 missense possibly damaging 0.80
R0265:Ttll7 UTSW 3 146944160 nonsense probably null
R0358:Ttll7 UTSW 3 146944116 missense probably benign
R0363:Ttll7 UTSW 3 146944215 missense probably benign 0.00
R0364:Ttll7 UTSW 3 146945181 missense possibly damaging 0.82
R0751:Ttll7 UTSW 3 146939991 missense probably damaging 1.00
R1184:Ttll7 UTSW 3 146939991 missense probably damaging 1.00
R1533:Ttll7 UTSW 3 146896667 missense probably damaging 1.00
R1771:Ttll7 UTSW 3 146894405 missense probably benign 0.02
R1789:Ttll7 UTSW 3 146915780 missense probably damaging 1.00
R1961:Ttll7 UTSW 3 146915795 splice site probably benign
R1995:Ttll7 UTSW 3 146961755 missense possibly damaging 0.95
R2083:Ttll7 UTSW 3 146930104 missense possibly damaging 0.77
R2152:Ttll7 UTSW 3 146930189 missense probably damaging 1.00
R2655:Ttll7 UTSW 3 146947621 missense probably damaging 1.00
R2926:Ttll7 UTSW 3 146930415 nonsense probably null
R4888:Ttll7 UTSW 3 146894177 start codon destroyed probably null 0.99
R4999:Ttll7 UTSW 3 146894469 missense probably damaging 1.00
R5648:Ttll7 UTSW 3 146961710 missense probably damaging 1.00
R5937:Ttll7 UTSW 3 146944092 nonsense probably null
R6036:Ttll7 UTSW 3 146940162 missense probably benign
R6036:Ttll7 UTSW 3 146940162 missense probably benign
R6463:Ttll7 UTSW 3 146931582 missense possibly damaging 0.86
R6747:Ttll7 UTSW 3 146944056 missense probably benign 0.02
R6922:Ttll7 UTSW 3 146909614 missense possibly damaging 0.92
R7123:Ttll7 UTSW 3 146913296 missense possibly damaging 0.95
R7211:Ttll7 UTSW 3 146913276 missense probably damaging 0.97
RF015:Ttll7 UTSW 3 146979658 missense probably benign 0.00
X0024:Ttll7 UTSW 3 146909553 missense probably damaging 1.00
X0026:Ttll7 UTSW 3 146961695 missense probably damaging 1.00
X0027:Ttll7 UTSW 3 146947653 missense probably damaging 1.00
Z1176:Ttll7 UTSW 3 146915771 missense not run
Z1176:Ttll7 UTSW 3 146930178 missense not run
Z1176:Ttll7 UTSW 3 146947635 missense not run
Predicted Primers PCR Primer
(F):5'- TAAAGTTTCCTGAAGCCTTTGCC -3'
(R):5'- TCTAGAGTGTGAGGCAACGC -3'

Sequencing Primer
(F):5'- CCTGAAGCCTTTGCCTTTAATG -3'
(R):5'- GGTTTTGCCTTCACTGAACACAAAG -3'
Posted On2017-06-26