Incidental Mutation 'R6009:Naaa'
ID479641
Institutional Source Beutler Lab
Gene Symbol Naaa
Ensembl Gene ENSMUSG00000029413
Gene NameN-acylethanolamine acid amidase
Synonyms3830414F09Rik, Asahl, 2210023K21Rik
MMRRC Submission 044186-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6009 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location92257659-92278170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92259581 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 353 (L353Q)
Ref Sequence ENSEMBL: ENSMUSP00000124582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113102] [ENSMUST00000159345] [ENSMUST00000175656] [ENSMUST00000201130]
Predicted Effect probably benign
Transcript: ENSMUST00000113102
AA Change: L355Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108726
Gene: ENSMUSG00000029413
AA Change: L355Q

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NAAA-beta 36 127 7.3e-26 PFAM
Pfam:CBAH 131 362 9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159345
AA Change: L353Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124582
Gene: ENSMUSG00000029413
AA Change: L353Q

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NAAA-beta 36 125 1.3e-23 PFAM
Pfam:CBAH 129 360 1.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159732
Predicted Effect silent
Transcript: ENSMUST00000175656
Predicted Effect probably benign
Transcript: ENSMUST00000201130
SMART Domains Protein: ENSMUSP00000144157
Gene: ENSMUSG00000029410

DomainStartEndE-ValueType
IQ 18 40 3.48e-1 SMART
PP2Ac 141 544 1.97e-118 SMART
EFh 576 604 3.25e1 SMART
EFh 660 688 5.44e-3 SMART
EFh 700 728 1.67e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N-acylethanolamine-hydrolyzing enzyme which is highly similar to acid ceramidase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,978,497 probably benign Het
Afap1 T C 5: 35,997,560 S683P probably damaging Het
Chid1 T A 7: 141,529,580 D131V probably damaging Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Crlf1 A C 8: 70,503,479 K403T probably damaging Het
Ctdspl2 T G 2: 121,988,838 N201K probably benign Het
Cyb561a3 G A 19: 10,586,808 V171I possibly damaging Het
Dazap1 T C 10: 80,285,304 probably benign Het
Dbf4 G T 5: 8,403,718 Q235K probably damaging Het
Dgka C T 10: 128,723,679 G471D probably damaging Het
Fam13b A T 18: 34,497,405 F100Y possibly damaging Het
Flii A T 11: 60,720,757 L376* probably null Het
Fnip1 G T 11: 54,502,271 G487V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golgb1 G T 16: 36,914,959 A1523S probably damaging Het
Gstm4 A G 3: 108,043,343 V114A possibly damaging Het
Gtf3c1 A G 7: 125,647,430 F1569S possibly damaging Het
Gtf3c5 A T 2: 28,571,165 D312E probably benign Het
Gtpbp1 G A 15: 79,712,096 V149M probably damaging Het
Hoxa7 C T 6: 52,217,387 V7M probably damaging Het
Il17f C T 1: 20,779,286 probably null Het
Ints9 T C 14: 65,008,082 V263A probably benign Het
Kansl1l C T 1: 66,735,600 C689Y probably benign Het
Kctd7 G A 5: 130,145,198 G39E probably damaging Het
Krt82 T A 15: 101,545,105 D282V probably benign Het
Lemd1 G T 1: 132,228,252 E11* probably null Het
Maml2 A G 9: 13,620,998 T503A probably benign Het
Mief2 A G 11: 60,731,659 T352A probably benign Het
Msantd1 C A 5: 34,917,705 T37K probably benign Het
Mtus2 A G 5: 148,306,652 E94G probably damaging Het
Nek5 T C 8: 22,120,822 E55G probably benign Het
Npat T C 9: 53,563,449 M847T probably damaging Het
Nus1 G A 10: 52,433,443 V268I probably benign Het
Olfr550 A G 7: 102,578,594 N33S possibly damaging Het
Parn C T 16: 13,667,564 D23N probably damaging Het
Pdgfa T C 5: 138,979,199 E176G probably damaging Het
Plcl1 T A 1: 55,696,246 F249I probably damaging Het
Plscr5 C T 9: 92,204,435 Q153* probably null Het
Polr2b T C 5: 77,320,252 I133T probably benign Het
Polr3c A G 3: 96,713,614 S463P probably damaging Het
Pprc1 A T 19: 46,071,732 I1530L probably damaging Het
Prex1 C T 2: 166,581,984 S996N probably damaging Het
Rnf169 C A 7: 99,927,123 R291S possibly damaging Het
Setd5 A G 6: 113,110,519 K127R probably damaging Het
Slc25a26 G T 6: 94,510,826 V89L probably benign Het
Slc4a10 A G 2: 62,046,690 T16A probably benign Het
Smchd1 A T 17: 71,440,956 H430Q probably damaging Het
Ttll7 A T 3: 146,934,535 D503V probably damaging Het
Vav2 A T 2: 27,271,900 probably null Het
Zfp345 A T 2: 150,472,517 C367S probably damaging Het
Zfp651 T C 9: 121,762,871 S86P possibly damaging Het
Zfp964 T A 8: 69,663,456 H235Q possibly damaging Het
Other mutations in Naaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Naaa APN 5 92265133 missense probably benign 0.32
IGL01470:Naaa APN 5 92263648 missense probably damaging 1.00
IGL01990:Naaa APN 5 92268063 missense possibly damaging 0.75
IGL02222:Naaa APN 5 92259550 unclassified probably benign
R0254:Naaa UTSW 5 92265135 missense probably damaging 1.00
R1658:Naaa UTSW 5 92272441 splice site probably null
R1930:Naaa UTSW 5 92278035 missense probably benign
R1931:Naaa UTSW 5 92278035 missense probably benign
R3788:Naaa UTSW 5 92272554 unclassified probably null
R4182:Naaa UTSW 5 92272554 unclassified probably null
R4373:Naaa UTSW 5 92278143 utr 5 prime probably benign
R4547:Naaa UTSW 5 92263586 splice site probably null
R5198:Naaa UTSW 5 92268045 nonsense probably null
R5732:Naaa UTSW 5 92263455 missense probably damaging 1.00
R7037:Naaa UTSW 5 92277075 missense possibly damaging 0.46
R7540:Naaa UTSW 5 92263724 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TACCTACTGATTGGGCATCATATG -3'
(R):5'- ACAAGCCAGTTAGACCTCTTG -3'

Sequencing Primer
(F):5'- TCTGTGAGAAGCACTCAC -3'
(R):5'- ACGTTTTAAACATTCTGCCTCTTTG -3'
Posted On2017-06-26