Incidental Mutation 'R6009:Mtus2'
ID479644
Institutional Source Beutler Lab
Gene Symbol Mtus2
Ensembl Gene ENSMUSG00000029651
Gene Namemicrotubule associated tumor suppressor candidate 2
Synonyms
MMRRC Submission 044186-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R6009 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location147957320-148316065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148306652 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 94 (E94G)
Ref Sequence ENSEMBL: ENSMUSP00000123055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071878] [ENSMUST00000085554] [ENSMUST00000085558] [ENSMUST00000110514] [ENSMUST00000110515] [ENSMUST00000146425] [ENSMUST00000152105]
Predicted Effect silent
Transcript: ENSMUST00000071878
SMART Domains Protein: ENSMUSP00000071775
Gene: ENSMUSG00000029651

DomainStartEndE-ValueType
coiled coil region 19 75 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085554
AA Change: E57G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082690
Gene: ENSMUSG00000029651
AA Change: E57G

DomainStartEndE-ValueType
coiled coil region 15 118 N/A INTRINSIC
low complexity region 131 148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085558
AA Change: E1258G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082694
Gene: ENSMUSG00000029651
AA Change: E1258G

DomainStartEndE-ValueType
internal_repeat_1 57 290 2.46e-5 PROSPERO
internal_repeat_1 312 525 2.46e-5 PROSPERO
low complexity region 530 541 N/A INTRINSIC
low complexity region 802 818 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
coiled coil region 1029 1080 N/A INTRINSIC
SCOP:d1fxkc_ 1167 1294 3e-4 SMART
low complexity region 1332 1349 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110514
AA Change: E220G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106143
Gene: ENSMUSG00000029651
AA Change: E220G

DomainStartEndE-ValueType
coiled coil region 19 75 N/A INTRINSIC
coiled coil region 144 281 N/A INTRINSIC
low complexity region 294 311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110515
AA Change: E253G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106144
Gene: ENSMUSG00000029651
AA Change: E253G

DomainStartEndE-ValueType
coiled coil region 19 75 N/A INTRINSIC
coiled coil region 144 314 N/A INTRINSIC
low complexity region 327 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146425
Predicted Effect probably damaging
Transcript: ENSMUST00000152105
AA Change: E94G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123055
Gene: ENSMUSG00000029651
AA Change: E94G

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
coiled coil region 52 155 N/A INTRINSIC
Meta Mutation Damage Score 0.2334 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,978,497 probably benign Het
Afap1 T C 5: 35,997,560 S683P probably damaging Het
Chid1 T A 7: 141,529,580 D131V probably damaging Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Crlf1 A C 8: 70,503,479 K403T probably damaging Het
Ctdspl2 T G 2: 121,988,838 N201K probably benign Het
Cyb561a3 G A 19: 10,586,808 V171I possibly damaging Het
Dazap1 T C 10: 80,285,304 probably benign Het
Dbf4 G T 5: 8,403,718 Q235K probably damaging Het
Dgka C T 10: 128,723,679 G471D probably damaging Het
Fam13b A T 18: 34,497,405 F100Y possibly damaging Het
Flii A T 11: 60,720,757 L376* probably null Het
Fnip1 G T 11: 54,502,271 G487V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golgb1 G T 16: 36,914,959 A1523S probably damaging Het
Gstm4 A G 3: 108,043,343 V114A possibly damaging Het
Gtf3c1 A G 7: 125,647,430 F1569S possibly damaging Het
Gtf3c5 A T 2: 28,571,165 D312E probably benign Het
Gtpbp1 G A 15: 79,712,096 V149M probably damaging Het
Hoxa7 C T 6: 52,217,387 V7M probably damaging Het
Il17f C T 1: 20,779,286 probably null Het
Ints9 T C 14: 65,008,082 V263A probably benign Het
Kansl1l C T 1: 66,735,600 C689Y probably benign Het
Kctd7 G A 5: 130,145,198 G39E probably damaging Het
Krt82 T A 15: 101,545,105 D282V probably benign Het
Lemd1 G T 1: 132,228,252 E11* probably null Het
Maml2 A G 9: 13,620,998 T503A probably benign Het
Mief2 A G 11: 60,731,659 T352A probably benign Het
Msantd1 C A 5: 34,917,705 T37K probably benign Het
Naaa A T 5: 92,259,581 L353Q probably benign Het
Nek5 T C 8: 22,120,822 E55G probably benign Het
Npat T C 9: 53,563,449 M847T probably damaging Het
Nus1 G A 10: 52,433,443 V268I probably benign Het
Olfr550 A G 7: 102,578,594 N33S possibly damaging Het
Parn C T 16: 13,667,564 D23N probably damaging Het
Pdgfa T C 5: 138,979,199 E176G probably damaging Het
Plcl1 T A 1: 55,696,246 F249I probably damaging Het
Plscr5 C T 9: 92,204,435 Q153* probably null Het
Polr2b T C 5: 77,320,252 I133T probably benign Het
Polr3c A G 3: 96,713,614 S463P probably damaging Het
Pprc1 A T 19: 46,071,732 I1530L probably damaging Het
Prex1 C T 2: 166,581,984 S996N probably damaging Het
Rnf169 C A 7: 99,927,123 R291S possibly damaging Het
Setd5 A G 6: 113,110,519 K127R probably damaging Het
Slc25a26 G T 6: 94,510,826 V89L probably benign Het
Slc4a10 A G 2: 62,046,690 T16A probably benign Het
Smchd1 A T 17: 71,440,956 H430Q probably damaging Het
Ttll7 A T 3: 146,934,535 D503V probably damaging Het
Vav2 A T 2: 27,271,900 probably null Het
Zfp345 A T 2: 150,472,517 C367S probably damaging Het
Zfp651 T C 9: 121,762,871 S86P possibly damaging Het
Zfp964 T A 8: 69,663,456 H235Q possibly damaging Het
Other mutations in Mtus2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Mtus2 APN 5 148077009 unclassified probably null
IGL01911:Mtus2 APN 5 148078220 missense probably benign 0.00
IGL01973:Mtus2 APN 5 148303476 splice site probably benign
IGL02452:Mtus2 APN 5 148077663 missense probably benign 0.01
IGL02476:Mtus2 APN 5 148077938 missense probably benign 0.01
IGL02716:Mtus2 APN 5 148236310 missense probably benign 0.05
IGL03194:Mtus2 APN 5 148107103 missense probably damaging 1.00
rumblado UTSW 5 148306708 nonsense probably null
IGL02991:Mtus2 UTSW 5 148313500 missense probably damaging 1.00
PIT4431001:Mtus2 UTSW 5 148076705 missense probably benign 0.01
R0101:Mtus2 UTSW 5 148083035 missense probably damaging 1.00
R0101:Mtus2 UTSW 5 148083035 missense probably damaging 1.00
R0310:Mtus2 UTSW 5 148107019 missense probably benign 0.17
R0729:Mtus2 UTSW 5 148077287 missense probably benign 0.08
R0968:Mtus2 UTSW 5 148078184 missense probably benign 0.09
R1231:Mtus2 UTSW 5 148077388 missense probably benign 0.01
R1253:Mtus2 UTSW 5 148303570 nonsense probably null
R1556:Mtus2 UTSW 5 148077388 missense probably benign 0.01
R1561:Mtus2 UTSW 5 148076552 missense probably benign 0.07
R1574:Mtus2 UTSW 5 148076552 missense probably benign 0.07
R1750:Mtus2 UTSW 5 148277633 missense probably damaging 0.97
R2318:Mtus2 UTSW 5 148107082 nonsense probably null
R2327:Mtus2 UTSW 5 148077915 missense probably benign 0.00
R3153:Mtus2 UTSW 5 148083060 missense probably damaging 1.00
R3154:Mtus2 UTSW 5 148303273 intron probably benign
R3158:Mtus2 UTSW 5 148231827 missense probably damaging 1.00
R3548:Mtus2 UTSW 5 148295506 missense probably damaging 1.00
R3861:Mtus2 UTSW 5 148313413 missense probably damaging 1.00
R4395:Mtus2 UTSW 5 148076622 missense probably benign 0.17
R4396:Mtus2 UTSW 5 148203938 missense possibly damaging 0.81
R4667:Mtus2 UTSW 5 148298260 missense possibly damaging 0.64
R4887:Mtus2 UTSW 5 148077103 nonsense probably null
R4931:Mtus2 UTSW 5 148077416 missense probably benign 0.09
R5097:Mtus2 UTSW 5 148295582 missense probably damaging 0.99
R5318:Mtus2 UTSW 5 148076572 missense probably benign 0.05
R5372:Mtus2 UTSW 5 148313412 missense probably damaging 1.00
R5388:Mtus2 UTSW 5 148306708 nonsense probably null
R5622:Mtus2 UTSW 5 148078434 missense probably benign 0.09
R6379:Mtus2 UTSW 5 148077198 missense probably benign 0.00
R6409:Mtus2 UTSW 5 148077615 missense probably benign
R6527:Mtus2 UTSW 5 148277598 critical splice acceptor site probably null
R6853:Mtus2 UTSW 5 148107011 missense probably damaging 1.00
R7001:Mtus2 UTSW 5 148277628 missense probably damaging 1.00
R7187:Mtus2 UTSW 5 148076705 missense probably benign 0.01
R7276:Mtus2 UTSW 5 148076558 missense probably benign
R7594:Mtus2 UTSW 5 148077406 missense probably benign 0.44
X0017:Mtus2 UTSW 5 148277600 missense possibly damaging 0.83
X0028:Mtus2 UTSW 5 148077318 missense probably benign 0.03
Z1088:Mtus2 UTSW 5 148303263 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGTGCACTCCGGCATTTTCTG -3'
(R):5'- ACCAGGAGATGATTCAGACTGG -3'

Sequencing Primer
(F):5'- CTCTGACTTTCTGAAAAGGGCTATGC -3'
(R):5'- TTCAGACTGGATACTGCGAC -3'
Posted On2017-06-26