Mutagenetix > Incidental Mutations

Incidental Mutation 'R6009:Rnf169'

479648

Institutional Source

Beutler Lab

Gene Symbol

Rnf169

Ensembl Gene

ENSMUSG00000058761

Gene Name

ring finger protein 169

Synonyms

2900057K09Rik

MMRRC Submission

044186-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R6009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99920254-99980448 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 99927123 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 291 (R291S)

Ref Sequence

ENSEMBL: ENSMUSP00000079631 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080817]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000080817
AA Change: R291S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000079631
Gene: ENSMUSG00000058761
AA Change: R291S

Domain	Start	End	E-Value	Type
low complexity region	2	27	N/A	INTRINSIC
low complexity region	32	46	N/A	INTRINSIC
RING	61	96	3.16e-1	SMART
Blast:RING	133	176	7e-8	BLAST
low complexity region	302	314	N/A	INTRINSIC
low complexity region	649	661	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.3%
20x: 91.5%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr8	A	G	14: 29,978,497		probably benign	Het
Afap1	T	C	5: 35,997,560	S683P	probably damaging	Het
Chid1	T	A	7: 141,529,580	D131V	probably damaging	Het
Clstn2	C	T	9: 97,456,526	R860Q	probably benign	Het
Crlf1	A	C	8: 70,503,479	K403T	probably damaging	Het
Ctdspl2	T	G	2: 121,988,838	N201K	probably benign	Het
Cyb561a3	G	A	19: 10,586,808	V171I	possibly damaging	Het
Dazap1	T	C	10: 80,285,304		probably benign	Het
Dbf4	G	T	5: 8,403,718	Q235K	probably damaging	Het
Dgka	C	T	10: 128,723,679	G471D	probably damaging	Het
Fam13b	A	T	18: 34,497,405	F100Y	possibly damaging	Het
Flii	A	T	11: 60,720,757	L376*	probably null	Het
Fnip1	G	T	11: 54,502,271	G487V	probably damaging	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Golgb1	G	T	16: 36,914,959	A1523S	probably damaging	Het
Gstm4	A	G	3: 108,043,343	V114A	possibly damaging	Het
Gtf3c1	A	G	7: 125,647,430	F1569S	possibly damaging	Het
Gtf3c5	A	T	2: 28,571,165	D312E	probably benign	Het
Gtpbp1	G	A	15: 79,712,096	V149M	probably damaging	Het
Hoxa7	C	T	6: 52,217,387	V7M	probably damaging	Het
Il17f	C	T	1: 20,779,286		probably null	Het
Ints9	T	C	14: 65,008,082	V263A	probably benign	Het
Kansl1l	C	T	1: 66,735,600	C689Y	probably benign	Het
Kctd7	G	A	5: 130,145,198	G39E	probably damaging	Het
Krt82	T	A	15: 101,545,105	D282V	probably benign	Het
Lemd1	G	T	1: 132,228,252	E11*	probably null	Het
Maml2	A	G	9: 13,620,998	T503A	probably benign	Het
Mief2	A	G	11: 60,731,659	T352A	probably benign	Het
Msantd1	C	A	5: 34,917,705	T37K	probably benign	Het
Mtus2	A	G	5: 148,306,652	E94G	probably damaging	Het
Naaa	A	T	5: 92,259,581	L353Q	probably benign	Het
Nek5	T	C	8: 22,120,822	E55G	probably benign	Het
Npat	T	C	9: 53,563,449	M847T	probably damaging	Het
Nus1	G	A	10: 52,433,443	V268I	probably benign	Het
Olfr550	A	G	7: 102,578,594	N33S	possibly damaging	Het
Parn	C	T	16: 13,667,564	D23N	probably damaging	Het
Pdgfa	T	C	5: 138,979,199	E176G	probably damaging	Het
Plcl1	T	A	1: 55,696,246	F249I	probably damaging	Het
Plscr5	C	T	9: 92,204,435	Q153*	probably null	Het
Polr2b	T	C	5: 77,320,252	I133T	probably benign	Het
Polr3c	A	G	3: 96,713,614	S463P	probably damaging	Het
Pprc1	A	T	19: 46,071,732	I1530L	probably damaging	Het
Prex1	C	T	2: 166,581,984	S996N	probably damaging	Het
Setd5	A	G	6: 113,110,519	K127R	probably damaging	Het
Slc25a26	G	T	6: 94,510,826	V89L	probably benign	Het
Slc4a10	A	G	2: 62,046,690	T16A	probably benign	Het
Smchd1	A	T	17: 71,440,956	H430Q	probably damaging	Het
Ttll7	A	T	3: 146,934,535	D503V	probably damaging	Het
Vav2	A	T	2: 27,271,900		probably null	Het
Zfp345	A	T	2: 150,472,517	C367S	probably damaging	Het
Zfp651	T	C	9: 121,762,871	S86P	possibly damaging	Het
Zfp964	T	A	8: 69,663,456	H235Q	possibly damaging	Het

Other mutations in Rnf169

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01476:Rnf169	APN	7	99955484	missense	probably damaging	1.00
IGL02344:Rnf169	APN	7	99926435	missense	probably damaging	1.00
IGL03066:Rnf169	APN	7	99925553	missense	possibly damaging	0.85
R0201:Rnf169	UTSW	7	99926003	missense	possibly damaging	0.85
R1087:Rnf169	UTSW	7	99942997	missense	probably benign	0.01
R1289:Rnf169	UTSW	7	99925736	missense	probably benign	0.01
R1476:Rnf169	UTSW	7	99925328	missense	possibly damaging	0.72
R1912:Rnf169	UTSW	7	99926254	missense	probably damaging	1.00
R1964:Rnf169	UTSW	7	99925525	missense	probably damaging	1.00
R2057:Rnf169	UTSW	7	99925408	missense	probably damaging	1.00
R2342:Rnf169	UTSW	7	99925445	missense	possibly damaging	0.87
R4755:Rnf169	UTSW	7	99925723	missense	probably benign	0.01
R4801:Rnf169	UTSW	7	99926446	missense	probably damaging	1.00
R4802:Rnf169	UTSW	7	99926446	missense	probably damaging	1.00
R5391:Rnf169	UTSW	7	99935160	critical splice donor site	probably null
R5395:Rnf169	UTSW	7	99935160	critical splice donor site	probably null
R5643:Rnf169	UTSW	7	99927131	missense	possibly damaging	0.85
R5817:Rnf169	UTSW	7	99925769	missense	probably benign	0.02
R5952:Rnf169	UTSW	7	99925633	missense	probably damaging	1.00
R6453:Rnf169	UTSW	7	99935227	missense	probably benign	0.01
R7238:Rnf169	UTSW	7	99925747	missense	probably benign	0.10
R7500:Rnf169	UTSW	7	99980238	missense	probably damaging	0.99
R8194:Rnf169	UTSW	7	99926444	missense	probably damaging	1.00
Z1177:Rnf169	UTSW	7	99925861	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGAAAGGTTTCTATAATGGCTCCCC -3'
(R):5'- AGCTACCTATGGGGATTGTCTTTC -3'

Sequencing Primer
(F):5'- CCCATCTGTCTACTAATTTGAACC -3'
(R):5'- CTTTCTTGAGAAATGGCTTAGAATGG -3'

Posted On

2017-06-26