Incidental Mutation 'R6009:Olfr550'
ID479649
Institutional Source Beutler Lab
Gene Symbol Olfr550
Ensembl Gene ENSMUSG00000073975
Gene Nameolfactory receptor 550
SynonymsMOR16-1, GA_x6K02T2PBJ9-5297243-5298193
MMRRC Submission 044186-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6009 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102571442-102583011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102578594 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 33 (N33S)
Ref Sequence ENSEMBL: ENSMUSP00000149536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098225] [ENSMUST00000213540] [ENSMUST00000216524]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098225
AA Change: N33S

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095828
Gene: ENSMUSG00000073975
AA Change: N33S

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 6.2e-102 PFAM
Pfam:7TM_GPCR_Srsx 36 156 1.8e-10 PFAM
Pfam:7tm_1 42 293 4.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213540
Predicted Effect possibly damaging
Transcript: ENSMUST00000216524
AA Change: N33S

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,978,497 probably benign Het
Afap1 T C 5: 35,997,560 S683P probably damaging Het
Chid1 T A 7: 141,529,580 D131V probably damaging Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Crlf1 A C 8: 70,503,479 K403T probably damaging Het
Ctdspl2 T G 2: 121,988,838 N201K probably benign Het
Cyb561a3 G A 19: 10,586,808 V171I possibly damaging Het
Dazap1 T C 10: 80,285,304 probably benign Het
Dbf4 G T 5: 8,403,718 Q235K probably damaging Het
Dgka C T 10: 128,723,679 G471D probably damaging Het
Fam13b A T 18: 34,497,405 F100Y possibly damaging Het
Flii A T 11: 60,720,757 L376* probably null Het
Fnip1 G T 11: 54,502,271 G487V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golgb1 G T 16: 36,914,959 A1523S probably damaging Het
Gstm4 A G 3: 108,043,343 V114A possibly damaging Het
Gtf3c1 A G 7: 125,647,430 F1569S possibly damaging Het
Gtf3c5 A T 2: 28,571,165 D312E probably benign Het
Gtpbp1 G A 15: 79,712,096 V149M probably damaging Het
Hoxa7 C T 6: 52,217,387 V7M probably damaging Het
Il17f C T 1: 20,779,286 probably null Het
Ints9 T C 14: 65,008,082 V263A probably benign Het
Kansl1l C T 1: 66,735,600 C689Y probably benign Het
Kctd7 G A 5: 130,145,198 G39E probably damaging Het
Krt82 T A 15: 101,545,105 D282V probably benign Het
Lemd1 G T 1: 132,228,252 E11* probably null Het
Maml2 A G 9: 13,620,998 T503A probably benign Het
Mief2 A G 11: 60,731,659 T352A probably benign Het
Msantd1 C A 5: 34,917,705 T37K probably benign Het
Mtus2 A G 5: 148,306,652 E94G probably damaging Het
Naaa A T 5: 92,259,581 L353Q probably benign Het
Nek5 T C 8: 22,120,822 E55G probably benign Het
Npat T C 9: 53,563,449 M847T probably damaging Het
Nus1 G A 10: 52,433,443 V268I probably benign Het
Parn C T 16: 13,667,564 D23N probably damaging Het
Pdgfa T C 5: 138,979,199 E176G probably damaging Het
Plcl1 T A 1: 55,696,246 F249I probably damaging Het
Plscr5 C T 9: 92,204,435 Q153* probably null Het
Polr2b T C 5: 77,320,252 I133T probably benign Het
Polr3c A G 3: 96,713,614 S463P probably damaging Het
Pprc1 A T 19: 46,071,732 I1530L probably damaging Het
Prex1 C T 2: 166,581,984 S996N probably damaging Het
Rnf169 C A 7: 99,927,123 R291S possibly damaging Het
Setd5 A G 6: 113,110,519 K127R probably damaging Het
Slc25a26 G T 6: 94,510,826 V89L probably benign Het
Slc4a10 A G 2: 62,046,690 T16A probably benign Het
Smchd1 A T 17: 71,440,956 H430Q probably damaging Het
Ttll7 A T 3: 146,934,535 D503V probably damaging Het
Vav2 A T 2: 27,271,900 probably null Het
Zfp345 A T 2: 150,472,517 C367S probably damaging Het
Zfp651 T C 9: 121,762,871 S86P possibly damaging Het
Zfp964 T A 8: 69,663,456 H235Q possibly damaging Het
Other mutations in Olfr550
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01946:Olfr550 APN 7 102578527 unclassified probably null
IGL02605:Olfr550 APN 7 102579395 missense probably damaging 1.00
IGL03365:Olfr550 APN 7 102578629 missense probably benign
R0180:Olfr550 UTSW 7 102579032 missense probably damaging 1.00
R3854:Olfr550 UTSW 7 102579020 missense probably damaging 1.00
R5337:Olfr550 UTSW 7 102579274 missense probably damaging 1.00
R5606:Olfr550 UTSW 7 102579274 missense probably damaging 1.00
R5646:Olfr550 UTSW 7 102579305 missense possibly damaging 0.84
R6751:Olfr550 UTSW 7 102578499 start codon destroyed probably null
R7767:Olfr550 UTSW 7 102571764 start gained probably benign
X0067:Olfr550 UTSW 7 102578500 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCAGAGAAGCAAGCACTCCTAG -3'
(R):5'- AGAAATCGAAGGGCAGCTCC -3'

Sequencing Primer
(F):5'- AATGGCTATGAGTCAGCTCTTC -3'
(R):5'- AGCTCCCGAGTACCCAG -3'
Posted On2017-06-26