Incidental Mutation 'R6009:Crlf1'
ID479654
Institutional Source Beutler Lab
Gene Symbol Crlf1
Ensembl Gene ENSMUSG00000007888
Gene Namecytokine receptor-like factor 1
SynonymsCLF-1, cytokine receptor like molecule 3, CRLM3
MMRRC Submission 044186-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.773) question?
Stock #R6009 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70493158-70504081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 70503479 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 403 (K403T)
Ref Sequence ENSEMBL: ENSMUSP00000008032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008032] [ENSMUST00000075175] [ENSMUST00000081940] [ENSMUST00000121623] [ENSMUST00000124967] [ENSMUST00000125184] [ENSMUST00000129909] [ENSMUST00000132648] [ENSMUST00000135446] [ENSMUST00000136913] [ENSMUST00000138260] [ENSMUST00000140679] [ENSMUST00000165126]
Predicted Effect probably damaging
Transcript: ENSMUST00000008032
AA Change: K403T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000008032
Gene: ENSMUSG00000007888
AA Change: K403T

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Lep_receptor_Ig 41 127 5.7e-8 PFAM
FN3 138 223 2.11e0 SMART
FN3 238 323 1.5e-5 SMART
low complexity region 345 361 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075175
SMART Domains Protein: ENSMUSP00000074670
Gene: ENSMUSG00000058833

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081940
SMART Domains Protein: ENSMUSP00000080608
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121623
SMART Domains Protein: ENSMUSP00000113804
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 14 99 3.3e-34 PFAM
UBQ 105 176 2.14e-36 SMART
Ribosomal_L40e 181 232 1.02e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124967
SMART Domains Protein: ENSMUSP00000122797
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 96 5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125184
SMART Domains Protein: ENSMUSP00000120096
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127793
Predicted Effect unknown
Transcript: ENSMUST00000127983
AA Change: K107T
SMART Domains Protein: ENSMUSP00000115614
Gene: ENSMUSG00000007888
AA Change: K107T

DomainStartEndE-ValueType
Blast:FN3 2 28 2e-12 BLAST
SCOP:d1eerb2 2 46 1e-8 SMART
low complexity region 50 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128620
Predicted Effect probably benign
Transcript: ENSMUST00000129909
SMART Domains Protein: ENSMUSP00000121149
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Ribosomal_L40e 77 128 1.02e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132107
Predicted Effect probably benign
Transcript: ENSMUST00000132648
SMART Domains Protein: ENSMUSP00000119545
Gene: ENSMUSG00000007888

DomainStartEndE-ValueType
FN3 16 101 2.11e0 SMART
low complexity region 104 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133683
Predicted Effect probably benign
Transcript: ENSMUST00000135446
SMART Domains Protein: ENSMUSP00000123562
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135773
Predicted Effect probably benign
Transcript: ENSMUST00000136913
SMART Domains Protein: ENSMUSP00000120446
Gene: ENSMUSG00000058833

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 4.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138196
Predicted Effect probably benign
Transcript: ENSMUST00000138260
SMART Domains Protein: ENSMUSP00000123438
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 12 99 9.2e-40 PFAM
UBQ 105 176 2.14e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140679
SMART Domains Protein: ENSMUSP00000123263
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143598
Predicted Effect probably benign
Transcript: ENSMUST00000165126
SMART Domains Protein: ENSMUSP00000137461
Gene: ENSMUSG00000090137

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_L40e 77 128 4.5e-33 PFAM
Meta Mutation Damage Score 0.3219 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a member of the cytokine type I receptor family. The encoded protein functions as a cytokine receptor subunit and may be involved in immune system regulation and fetal development. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted mutation fail to suckle effectively and do not survive beyond 24 hrs after birth. Newborns exhibit reduced numbers of hematopoietic progenitor cells as well as a significant reduction in the number of motoneurons in the lumbar spinal cord and facial nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,978,497 probably benign Het
Afap1 T C 5: 35,997,560 S683P probably damaging Het
Chid1 T A 7: 141,529,580 D131V probably damaging Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Ctdspl2 T G 2: 121,988,838 N201K probably benign Het
Cyb561a3 G A 19: 10,586,808 V171I possibly damaging Het
Dazap1 T C 10: 80,285,304 probably benign Het
Dbf4 G T 5: 8,403,718 Q235K probably damaging Het
Dgka C T 10: 128,723,679 G471D probably damaging Het
Fam13b A T 18: 34,497,405 F100Y possibly damaging Het
Flii A T 11: 60,720,757 L376* probably null Het
Fnip1 G T 11: 54,502,271 G487V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golgb1 G T 16: 36,914,959 A1523S probably damaging Het
Gstm4 A G 3: 108,043,343 V114A possibly damaging Het
Gtf3c1 A G 7: 125,647,430 F1569S possibly damaging Het
Gtf3c5 A T 2: 28,571,165 D312E probably benign Het
Gtpbp1 G A 15: 79,712,096 V149M probably damaging Het
Hoxa7 C T 6: 52,217,387 V7M probably damaging Het
Il17f C T 1: 20,779,286 probably null Het
Ints9 T C 14: 65,008,082 V263A probably benign Het
Kansl1l C T 1: 66,735,600 C689Y probably benign Het
Kctd7 G A 5: 130,145,198 G39E probably damaging Het
Krt82 T A 15: 101,545,105 D282V probably benign Het
Lemd1 G T 1: 132,228,252 E11* probably null Het
Maml2 A G 9: 13,620,998 T503A probably benign Het
Mief2 A G 11: 60,731,659 T352A probably benign Het
Msantd1 C A 5: 34,917,705 T37K probably benign Het
Mtus2 A G 5: 148,306,652 E94G probably damaging Het
Naaa A T 5: 92,259,581 L353Q probably benign Het
Nek5 T C 8: 22,120,822 E55G probably benign Het
Npat T C 9: 53,563,449 M847T probably damaging Het
Nus1 G A 10: 52,433,443 V268I probably benign Het
Olfr550 A G 7: 102,578,594 N33S possibly damaging Het
Parn C T 16: 13,667,564 D23N probably damaging Het
Pdgfa T C 5: 138,979,199 E176G probably damaging Het
Plcl1 T A 1: 55,696,246 F249I probably damaging Het
Plscr5 C T 9: 92,204,435 Q153* probably null Het
Polr2b T C 5: 77,320,252 I133T probably benign Het
Polr3c A G 3: 96,713,614 S463P probably damaging Het
Pprc1 A T 19: 46,071,732 I1530L probably damaging Het
Prex1 C T 2: 166,581,984 S996N probably damaging Het
Rnf169 C A 7: 99,927,123 R291S possibly damaging Het
Setd5 A G 6: 113,110,519 K127R probably damaging Het
Slc25a26 G T 6: 94,510,826 V89L probably benign Het
Slc4a10 A G 2: 62,046,690 T16A probably benign Het
Smchd1 A T 17: 71,440,956 H430Q probably damaging Het
Ttll7 A T 3: 146,934,535 D503V probably damaging Het
Vav2 A T 2: 27,271,900 probably null Het
Zfp345 A T 2: 150,472,517 C367S probably damaging Het
Zfp651 T C 9: 121,762,871 S86P possibly damaging Het
Zfp964 T A 8: 69,663,456 H235Q possibly damaging Het
Other mutations in Crlf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02878:Crlf1 APN 8 70503640 critical splice donor site probably null
R0317:Crlf1 UTSW 8 70498599 missense probably benign
R0398:Crlf1 UTSW 8 70499089 splice site probably benign
R0437:Crlf1 UTSW 8 70499514 unclassified probably null
R1191:Crlf1 UTSW 8 70498828 missense probably damaging 1.00
R1741:Crlf1 UTSW 8 70500906 missense probably damaging 0.99
R3730:Crlf1 UTSW 8 70499442 missense probably benign 0.03
R3731:Crlf1 UTSW 8 70499442 missense probably benign 0.03
R4467:Crlf1 UTSW 8 70500956 nonsense probably null
R5557:Crlf1 UTSW 8 70498667 missense probably benign 0.12
R6348:Crlf1 UTSW 8 70493340 missense probably benign
R6606:Crlf1 UTSW 8 70501174 missense probably damaging 1.00
X0062:Crlf1 UTSW 8 70498837 unclassified probably null
Predicted Primers PCR Primer
(F):5'- CATTCTCTTTAGAGCGCCCG -3'
(R):5'- GGAAAGGGCCTCATCTAGAC -3'

Sequencing Primer
(F):5'- GCTGGCTCAAGAAGCAC -3'
(R):5'- AAAGGGCCTCATCTAGACTGCTG -3'
Posted On2017-06-26