Mutagenetix > Incidental Mutations

Incidental Mutation 'R6009:Npat'

479656

Institutional Source

Beutler Lab

Gene Symbol

Npat

Ensembl Gene

ENSMUSG00000033054

Gene Name

nuclear protein in the AT region

Synonyms

MMRRC Submission

044186-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53537047-53574342 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53563449 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 847 (M847T)

Ref Sequence

ENSEMBL: ENSMUSP00000048709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035850]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035850
AA Change: M847T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000048709
Gene: ENSMUSG00000033054
AA Change: M847T

Domain	Start	End	E-Value	Type
LisH	3	35	3.09e-3	SMART
low complexity region	585	592	N/A	INTRINSIC
low complexity region	697	712	N/A	INTRINSIC
Pfam:NPAT_C	754	1420	4.7e-299	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148336

Meta Mutation Damage Score

0.4037

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.3%
20x: 91.5%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr8	A	G	14: 29,978,497		probably benign	Het
Afap1	T	C	5: 35,997,560	S683P	probably damaging	Het
Chid1	T	A	7: 141,529,580	D131V	probably damaging	Het
Clstn2	C	T	9: 97,456,526	R860Q	probably benign	Het
Crlf1	A	C	8: 70,503,479	K403T	probably damaging	Het
Ctdspl2	T	G	2: 121,988,838	N201K	probably benign	Het
Cyb561a3	G	A	19: 10,586,808	V171I	possibly damaging	Het
Dazap1	T	C	10: 80,285,304		probably benign	Het
Dbf4	G	T	5: 8,403,718	Q235K	probably damaging	Het
Dgka	C	T	10: 128,723,679	G471D	probably damaging	Het
Fam13b	A	T	18: 34,497,405	F100Y	possibly damaging	Het
Flii	A	T	11: 60,720,757	L376*	probably null	Het
Fnip1	G	T	11: 54,502,271	G487V	probably damaging	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Golgb1	G	T	16: 36,914,959	A1523S	probably damaging	Het
Gstm4	A	G	3: 108,043,343	V114A	possibly damaging	Het
Gtf3c1	A	G	7: 125,647,430	F1569S	possibly damaging	Het
Gtf3c5	A	T	2: 28,571,165	D312E	probably benign	Het
Gtpbp1	G	A	15: 79,712,096	V149M	probably damaging	Het
Hoxa7	C	T	6: 52,217,387	V7M	probably damaging	Het
Il17f	C	T	1: 20,779,286		probably null	Het
Ints9	T	C	14: 65,008,082	V263A	probably benign	Het
Kansl1l	C	T	1: 66,735,600	C689Y	probably benign	Het
Kctd7	G	A	5: 130,145,198	G39E	probably damaging	Het
Krt82	T	A	15: 101,545,105	D282V	probably benign	Het
Lemd1	G	T	1: 132,228,252	E11*	probably null	Het
Maml2	A	G	9: 13,620,998	T503A	probably benign	Het
Mief2	A	G	11: 60,731,659	T352A	probably benign	Het
Msantd1	C	A	5: 34,917,705	T37K	probably benign	Het
Mtus2	A	G	5: 148,306,652	E94G	probably damaging	Het
Naaa	A	T	5: 92,259,581	L353Q	probably benign	Het
Nek5	T	C	8: 22,120,822	E55G	probably benign	Het
Nus1	G	A	10: 52,433,443	V268I	probably benign	Het
Olfr550	A	G	7: 102,578,594	N33S	possibly damaging	Het
Parn	C	T	16: 13,667,564	D23N	probably damaging	Het
Pdgfa	T	C	5: 138,979,199	E176G	probably damaging	Het
Plcl1	T	A	1: 55,696,246	F249I	probably damaging	Het
Plscr5	C	T	9: 92,204,435	Q153*	probably null	Het
Polr2b	T	C	5: 77,320,252	I133T	probably benign	Het
Polr3c	A	G	3: 96,713,614	S463P	probably damaging	Het
Pprc1	A	T	19: 46,071,732	I1530L	probably damaging	Het
Prex1	C	T	2: 166,581,984	S996N	probably damaging	Het
Rnf169	C	A	7: 99,927,123	R291S	possibly damaging	Het
Setd5	A	G	6: 113,110,519	K127R	probably damaging	Het
Slc25a26	G	T	6: 94,510,826	V89L	probably benign	Het
Slc4a10	A	G	2: 62,046,690	T16A	probably benign	Het
Smchd1	A	T	17: 71,440,956	H430Q	probably damaging	Het
Ttll7	A	T	3: 146,934,535	D503V	probably damaging	Het
Vav2	A	T	2: 27,271,900		probably null	Het
Zfp345	A	T	2: 150,472,517	C367S	probably damaging	Het
Zfp651	T	C	9: 121,762,871	S86P	possibly damaging	Het
Zfp964	T	A	8: 69,663,456	H235Q	possibly damaging	Het

Other mutations in Npat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Npat	APN	9	53566800	missense	possibly damaging	0.82
IGL00503:Npat	APN	9	53572649	utr 3 prime	probably benign
IGL00694:Npat	APN	9	53563517	missense	probably benign	0.00
IGL00731:Npat	APN	9	53562086	missense	probably damaging	0.99
IGL00907:Npat	APN	9	53563290	missense	possibly damaging	0.64
IGL00949:Npat	APN	9	53563362	missense	probably benign	0.17
IGL01403:Npat	APN	9	53555129	missense	probably benign	0.02
IGL01626:Npat	APN	9	53556571	missense	possibly damaging	0.92
IGL01936:Npat	APN	9	53558226	splice site	probably benign
IGL02142:Npat	APN	9	53569907	missense	probably benign
IGL02215:Npat	APN	9	53559117	missense	probably benign	0.00
IGL02250:Npat	APN	9	53548951	nonsense	probably null
IGL02624:Npat	APN	9	53566810	missense	probably damaging	1.00
IGL02928:Npat	APN	9	53566838	splice site	probably benign
IGL02931:Npat	APN	9	53571041	nonsense	probably null
IGL03128:Npat	APN	9	53550033	splice site	probably benign
IGL03238:Npat	APN	9	53570426	missense	probably damaging	0.98
Flotsam	UTSW	9	53570570	nonsense	probably null
kindling	UTSW	9	53563449	missense	probably damaging	0.99
R0606:Npat	UTSW	9	53556481	critical splice donor site	probably null
R0688:Npat	UTSW	9	53570222	missense	probably benign	0.18
R0839:Npat	UTSW	9	53545180	missense	probably damaging	0.99
R0947:Npat	UTSW	9	53570324	missense	probably benign	0.08
R1070:Npat	UTSW	9	53572592	missense	probably damaging	1.00
R1480:Npat	UTSW	9	53563066	frame shift	probably null
R1599:Npat	UTSW	9	53562404	missense	possibly damaging	0.62
R1644:Npat	UTSW	9	53570172	missense	probably damaging	1.00
R1646:Npat	UTSW	9	53555134	missense	probably benign	0.32
R1699:Npat	UTSW	9	53562660	missense	probably benign
R1765:Npat	UTSW	9	53570222	missense	probably benign	0.00
R1793:Npat	UTSW	9	53552289	missense	probably damaging	1.00
R1866:Npat	UTSW	9	53563116	missense	probably damaging	1.00
R1898:Npat	UTSW	9	53563637	missense	probably damaging	1.00
R2018:Npat	UTSW	9	53562491	missense	probably benign	0.34
R2019:Npat	UTSW	9	53562491	missense	probably benign	0.34
R2213:Npat	UTSW	9	53552381	missense	probably benign	0.00
R2432:Npat	UTSW	9	53558135	missense	probably damaging	1.00
R3816:Npat	UTSW	9	53569916	missense	probably damaging	0.99
R4764:Npat	UTSW	9	53572620	missense	probably damaging	1.00
R4889:Npat	UTSW	9	53562207	missense	probably benign	0.00
R4895:Npat	UTSW	9	53570489	missense	probably damaging	1.00
R4923:Npat	UTSW	9	53571030	missense	probably damaging	1.00
R5377:Npat	UTSW	9	53550036	critical splice acceptor site	probably null
R5397:Npat	UTSW	9	53570474	missense	probably damaging	1.00
R5504:Npat	UTSW	9	53570264	missense	probably benign	0.01
R5509:Npat	UTSW	9	53570242	missense	probably benign	0.00
R5563:Npat	UTSW	9	53563127	missense	probably damaging	0.97
R5677:Npat	UTSW	9	53555100	missense	probably benign	0.00
R5868:Npat	UTSW	9	53570124	missense	probably damaging	0.96
R5927:Npat	UTSW	9	53562221	nonsense	probably null
R6247:Npat	UTSW	9	53545238	missense	probably damaging	1.00
R6434:Npat	UTSW	9	53563439	missense	possibly damaging	0.81
R6784:Npat	UTSW	9	53558158	missense	probably damaging	1.00
R6799:Npat	UTSW	9	53551630	missense	probably benign	0.21
R6878:Npat	UTSW	9	53556599	missense	probably benign
R7027:Npat	UTSW	9	53569916	missense	possibly damaging	0.90
R7383:Npat	UTSW	9	53562778	missense	probably benign
R7404:Npat	UTSW	9	53554933	splice site	probably null
R7408:Npat	UTSW	9	53569916	missense	probably damaging	0.99
R7444:Npat	UTSW	9	53548910	missense	probably damaging	0.97
R7755:Npat	UTSW	9	53559170	missense	possibly damaging	0.92
R7992:Npat	UTSW	9	53562867	missense	probably benign	0.00
R8108:Npat	UTSW	9	53571129	missense	probably benign	0.00
R8126:Npat	UTSW	9	53552334	missense	probably benign
R8213:Npat	UTSW	9	53570570	nonsense	probably null
R8354:Npat	UTSW	9	53566951	missense	possibly damaging	0.93
R8429:Npat	UTSW	9	53570609	nonsense	probably null
R8454:Npat	UTSW	9	53566951	missense	possibly damaging	0.93
Z1177:Npat	UTSW	9	53566828	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- TCAGAAGAAACTGCAAGTGCTG -3'
(R):5'- AGTTTGGCGACACAGCTTG -3'

Sequencing Primer
(F):5'- CTGCAAGTGCTGTTGTATCTG -3'
(R):5'- CAAACGCACTGTTAGATTTAGGTGG -3'

Posted On

2017-06-26