Mutagenetix > Incidental Mutations

Incidental Mutation 'R6009:Fnip1'

479663

Institutional Source

Beutler Lab

Gene Symbol

Fnip1

Ensembl Gene

ENSMUSG00000035992

Gene Name

folliculin interacting protein 1

Synonyms

A730024A03Rik

MMRRC Submission

044186-MU

Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Is this an essential gene?

Possibly essential (E-score: 0.615) question?

Stock #

R6009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

54438199-54518235 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 54502271 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 487 (G487V)

Ref Sequence

ENSEMBL: ENSMUSP00000121399 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046835] [ENSMUST00000143650]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046835
AA Change: G511V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992
AA Change: G511V

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	41	159	1.7e-29	PFAM
Pfam:FNIP_M	316	549	9.9e-92	PFAM
Pfam:FNIP_C	975	1161	7.6e-73	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000143650
AA Change: G487V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992
AA Change: G487V

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	17	139	3.9e-36	PFAM
Pfam:FNIP_M	288	526	5.1e-87	PFAM

Meta Mutation Damage Score

0.9195

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.3%
20x: 91.5%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr8	A	G	14: 29,978,497		probably benign	Het
Afap1	T	C	5: 35,997,560	S683P	probably damaging	Het
Chid1	T	A	7: 141,529,580	D131V	probably damaging	Het
Clstn2	C	T	9: 97,456,526	R860Q	probably benign	Het
Crlf1	A	C	8: 70,503,479	K403T	probably damaging	Het
Ctdspl2	T	G	2: 121,988,838	N201K	probably benign	Het
Cyb561a3	G	A	19: 10,586,808	V171I	possibly damaging	Het
Dazap1	T	C	10: 80,285,304		probably benign	Het
Dbf4	G	T	5: 8,403,718	Q235K	probably damaging	Het
Dgka	C	T	10: 128,723,679	G471D	probably damaging	Het
Fam13b	A	T	18: 34,497,405	F100Y	possibly damaging	Het
Flii	A	T	11: 60,720,757	L376*	probably null	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Golgb1	G	T	16: 36,914,959	A1523S	probably damaging	Het
Gstm4	A	G	3: 108,043,343	V114A	possibly damaging	Het
Gtf3c1	A	G	7: 125,647,430	F1569S	possibly damaging	Het
Gtf3c5	A	T	2: 28,571,165	D312E	probably benign	Het
Gtpbp1	G	A	15: 79,712,096	V149M	probably damaging	Het
Hoxa7	C	T	6: 52,217,387	V7M	probably damaging	Het
Il17f	C	T	1: 20,779,286		probably null	Het
Ints9	T	C	14: 65,008,082	V263A	probably benign	Het
Kansl1l	C	T	1: 66,735,600	C689Y	probably benign	Het
Kctd7	G	A	5: 130,145,198	G39E	probably damaging	Het
Krt82	T	A	15: 101,545,105	D282V	probably benign	Het
Lemd1	G	T	1: 132,228,252	E11*	probably null	Het
Maml2	A	G	9: 13,620,998	T503A	probably benign	Het
Mief2	A	G	11: 60,731,659	T352A	probably benign	Het
Msantd1	C	A	5: 34,917,705	T37K	probably benign	Het
Mtus2	A	G	5: 148,306,652	E94G	probably damaging	Het
Naaa	A	T	5: 92,259,581	L353Q	probably benign	Het
Nek5	T	C	8: 22,120,822	E55G	probably benign	Het
Npat	T	C	9: 53,563,449	M847T	probably damaging	Het
Nus1	G	A	10: 52,433,443	V268I	probably benign	Het
Olfr550	A	G	7: 102,578,594	N33S	possibly damaging	Het
Parn	C	T	16: 13,667,564	D23N	probably damaging	Het
Pdgfa	T	C	5: 138,979,199	E176G	probably damaging	Het
Plcl1	T	A	1: 55,696,246	F249I	probably damaging	Het
Plscr5	C	T	9: 92,204,435	Q153*	probably null	Het
Polr2b	T	C	5: 77,320,252	I133T	probably benign	Het
Polr3c	A	G	3: 96,713,614	S463P	probably damaging	Het
Pprc1	A	T	19: 46,071,732	I1530L	probably damaging	Het
Prex1	C	T	2: 166,581,984	S996N	probably damaging	Het
Rnf169	C	A	7: 99,927,123	R291S	possibly damaging	Het
Setd5	A	G	6: 113,110,519	K127R	probably damaging	Het
Slc25a26	G	T	6: 94,510,826	V89L	probably benign	Het
Slc4a10	A	G	2: 62,046,690	T16A	probably benign	Het
Smchd1	A	T	17: 71,440,956	H430Q	probably damaging	Het
Ttll7	A	T	3: 146,934,535	D503V	probably damaging	Het
Vav2	A	T	2: 27,271,900		probably null	Het
Zfp345	A	T	2: 150,472,517	C367S	probably damaging	Het
Zfp651	T	C	9: 121,762,871	S86P	possibly damaging	Het
Zfp964	T	A	8: 69,663,456	H235Q	possibly damaging	Het

Other mutations in Fnip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01449:Fnip1	APN	11	54499508	missense	probably damaging	1.00
IGL01590:Fnip1	APN	11	54493300	missense	probably damaging	1.00
IGL01959:Fnip1	APN	11	54490912	missense	possibly damaging	0.95
IGL02157:Fnip1	APN	11	54487763	missense	probably damaging	1.00
IGL02197:Fnip1	APN	11	54493374	missense	probably damaging	1.00
IGL02476:Fnip1	APN	11	54499567	splice site	probably benign
IGL02639:Fnip1	APN	11	54475640	nonsense	probably null
IGL02742:Fnip1	APN	11	54493351	missense	probably damaging	1.00
hamel	UTSW	11	54480685	critical splice donor site	probably benign
hamel2	UTSW	11	54502271	missense	probably damaging	1.00
Normandy	UTSW	11	54493181	splice site	probably benign
H8562:Fnip1	UTSW	11	54480297	missense	probably damaging	0.98
P0043:Fnip1	UTSW	11	54503225	missense	probably benign	0.00
R0114:Fnip1	UTSW	11	54487801	splice site	probably benign
R0278:Fnip1	UTSW	11	54489343	splice site	probably null
R0409:Fnip1	UTSW	11	54480354	splice site	probably null
R0840:Fnip1	UTSW	11	54493181	splice site	probably benign
R1131:Fnip1	UTSW	11	54493303	missense	possibly damaging	0.82
R1205:Fnip1	UTSW	11	54502306	missense	possibly damaging	0.91
R1271:Fnip1	UTSW	11	54503297	missense	probably benign
R1817:Fnip1	UTSW	11	54502453	missense	probably benign	0.30
R1826:Fnip1	UTSW	11	54466164	missense	probably damaging	1.00
R1872:Fnip1	UTSW	11	54487735	missense	probably damaging	1.00
R1883:Fnip1	UTSW	11	54515547	missense	probably damaging	1.00
R1917:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R1918:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R1919:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R2010:Fnip1	UTSW	11	54482503	missense	probably damaging	1.00
R2117:Fnip1	UTSW	11	54500624	missense	probably damaging	1.00
R2329:Fnip1	UTSW	11	54466107	missense	probably damaging	0.98
R2337:Fnip1	UTSW	11	54475737	missense	probably damaging	0.98
R2850:Fnip1	UTSW	11	54502677	missense	probably benign	0.32
R2863:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R2864:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R2865:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R3936:Fnip1	UTSW	11	54480239	splice site	probably null
R4017:Fnip1	UTSW	11	54509987	missense	probably benign	0.14
R4033:Fnip1	UTSW	11	54502471	missense	probably benign	0.02
R4668:Fnip1	UTSW	11	54503559	missense	probably damaging	1.00
R4695:Fnip1	UTSW	11	54499419	missense	probably damaging	1.00
R4762:Fnip1	UTSW	11	54466171	missense	probably damaging	1.00
R4762:Fnip1	UTSW	11	54499526	missense	probably benign	0.01
R4777:Fnip1	UTSW	11	54500556	missense	probably damaging	1.00
R4863:Fnip1	UTSW	11	54515556	missense	possibly damaging	0.52
R5369:Fnip1	UTSW	11	54502589	missense	probably benign
R5481:Fnip1	UTSW	11	54502644	missense	probably benign	0.01
R5562:Fnip1	UTSW	11	54489342	critical splice donor site	probably null
R5563:Fnip1	UTSW	11	54504862	missense	probably benign	0.05
R5628:Fnip1	UTSW	11	54503633	missense	probably benign	0.08
R5689:Fnip1	UTSW	11	54502289	missense	probably damaging	1.00
R6120:Fnip1	UTSW	11	54510000	missense	probably benign	0.23
R6429:Fnip1	UTSW	11	54515567	missense	probably damaging	1.00
R6546:Fnip1	UTSW	11	54502611	missense	probably benign	0.03
R6600:Fnip1	UTSW	11	54503099	missense	probably benign
R6882:Fnip1	UTSW	11	54509898	missense	probably damaging	1.00
R6966:Fnip1	UTSW	11	54482559	missense	probably benign	0.00
R7009:Fnip1	UTSW	11	54502935	missense	probably damaging	1.00
R7664:Fnip1	UTSW	11	54466125	missense	probably damaging	1.00
R7706:Fnip1	UTSW	11	54515499	missense	probably benign	0.41
R7866:Fnip1	UTSW	11	54465402	start gained	probably benign
R7949:Fnip1	UTSW	11	54465402	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAGCTGTTTAGAAACACAGC -3'
(R):5'- TGGTAGTAATCACTGTGCCTGG -3'

Sequencing Primer
(F):5'- AACAAAACCTGTTCACCTTTCTC -3'
(R):5'- CTGTGCCTGGCATAACAATG -3'

Posted On

2017-06-26