Incidental Mutation 'R6009:Flii'
ID479664
Institutional Source Beutler Lab
Gene Symbol Flii
Ensembl Gene ENSMUSG00000002812
Gene Nameflightless I actin binding protein
SynonymsFliih, 3632430F08Rik
MMRRC Submission 044186-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6009 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location60714123-60727263 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 60720757 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 376 (L376*)
Ref Sequence ENSEMBL: ENSMUSP00000002889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002889]
Predicted Effect probably null
Transcript: ENSMUST00000002889
AA Change: L376*
SMART Domains Protein: ENSMUSP00000002889
Gene: ENSMUSG00000002812
AA Change: L376*

DomainStartEndE-ValueType
LRR 55 78 1.08e-1 SMART
LRR 103 126 4.08e0 SMART
LRR 127 149 2.27e1 SMART
LRR 150 173 1.25e-1 SMART
LRR 222 244 6.78e1 SMART
LRR 245 268 2.86e-1 SMART
LRR 269 291 3.78e-1 SMART
LRR 316 339 2.82e0 SMART
LRR 340 362 2.27e2 SMART
low complexity region 403 420 N/A INTRINSIC
GEL 499 597 4.17e-25 SMART
GEL 617 709 1.72e-26 SMART
low complexity region 727 740 N/A INTRINSIC
GEL 745 838 2.24e-25 SMART
GEL 905 1039 1.13e-3 SMART
GEL 1056 1152 7.28e-16 SMART
GEL 1167 1263 5.51e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154465
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a protein with gelsolin-like repeats and an N-terminal leucine-rich repeat domain. The protein is similar to a Drosophila protein involved in early embryogenesis and the structural organization of indirect flight muscle. This protein may act as an actin-remodelling protein as well as a transcriptional coactivator. Homozygous knockout mice show embryonic lethality. This protein may act to regulate wound repair. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Embryos homozygous for a knock-out allele are able to initiate uterine implantation but degenerate rapidly thereafter. Heterozygous mutant mice display enhanced wound healing with increased epithelial migration and improved wound contraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,978,497 probably benign Het
Afap1 T C 5: 35,997,560 S683P probably damaging Het
Chid1 T A 7: 141,529,580 D131V probably damaging Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Crlf1 A C 8: 70,503,479 K403T probably damaging Het
Ctdspl2 T G 2: 121,988,838 N201K probably benign Het
Cyb561a3 G A 19: 10,586,808 V171I possibly damaging Het
Dazap1 T C 10: 80,285,304 probably benign Het
Dbf4 G T 5: 8,403,718 Q235K probably damaging Het
Dgka C T 10: 128,723,679 G471D probably damaging Het
Fam13b A T 18: 34,497,405 F100Y possibly damaging Het
Fnip1 G T 11: 54,502,271 G487V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golgb1 G T 16: 36,914,959 A1523S probably damaging Het
Gstm4 A G 3: 108,043,343 V114A possibly damaging Het
Gtf3c1 A G 7: 125,647,430 F1569S possibly damaging Het
Gtf3c5 A T 2: 28,571,165 D312E probably benign Het
Gtpbp1 G A 15: 79,712,096 V149M probably damaging Het
Hoxa7 C T 6: 52,217,387 V7M probably damaging Het
Il17f C T 1: 20,779,286 probably null Het
Ints9 T C 14: 65,008,082 V263A probably benign Het
Kansl1l C T 1: 66,735,600 C689Y probably benign Het
Kctd7 G A 5: 130,145,198 G39E probably damaging Het
Krt82 T A 15: 101,545,105 D282V probably benign Het
Lemd1 G T 1: 132,228,252 E11* probably null Het
Maml2 A G 9: 13,620,998 T503A probably benign Het
Mief2 A G 11: 60,731,659 T352A probably benign Het
Msantd1 C A 5: 34,917,705 T37K probably benign Het
Mtus2 A G 5: 148,306,652 E94G probably damaging Het
Naaa A T 5: 92,259,581 L353Q probably benign Het
Nek5 T C 8: 22,120,822 E55G probably benign Het
Npat T C 9: 53,563,449 M847T probably damaging Het
Nus1 G A 10: 52,433,443 V268I probably benign Het
Olfr550 A G 7: 102,578,594 N33S possibly damaging Het
Parn C T 16: 13,667,564 D23N probably damaging Het
Pdgfa T C 5: 138,979,199 E176G probably damaging Het
Plcl1 T A 1: 55,696,246 F249I probably damaging Het
Plscr5 C T 9: 92,204,435 Q153* probably null Het
Polr2b T C 5: 77,320,252 I133T probably benign Het
Polr3c A G 3: 96,713,614 S463P probably damaging Het
Pprc1 A T 19: 46,071,732 I1530L probably damaging Het
Prex1 C T 2: 166,581,984 S996N probably damaging Het
Rnf169 C A 7: 99,927,123 R291S possibly damaging Het
Setd5 A G 6: 113,110,519 K127R probably damaging Het
Slc25a26 G T 6: 94,510,826 V89L probably benign Het
Slc4a10 A G 2: 62,046,690 T16A probably benign Het
Smchd1 A T 17: 71,440,956 H430Q probably damaging Het
Ttll7 A T 3: 146,934,535 D503V probably damaging Het
Vav2 A T 2: 27,271,900 probably null Het
Zfp345 A T 2: 150,472,517 C367S probably damaging Het
Zfp651 T C 9: 121,762,871 S86P possibly damaging Het
Zfp964 T A 8: 69,663,456 H235Q possibly damaging Het
Other mutations in Flii
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Flii APN 11 60723415 missense probably benign 0.03
IGL00331:Flii APN 11 60715833 missense probably benign 0.40
IGL01530:Flii APN 11 60720182 nonsense probably null
IGL01678:Flii APN 11 60716846 unclassified probably benign
IGL01938:Flii APN 11 60715116 missense probably damaging 1.00
IGL02211:Flii APN 11 60718298 unclassified probably benign
IGL02626:Flii APN 11 60719859 missense probably benign 0.37
IGL03038:Flii APN 11 60724832 missense probably benign 0.01
IGL03412:Flii APN 11 60722640 missense probably damaging 0.99
Dry_tortugas UTSW 11 60720757 nonsense probably null
R0135:Flii UTSW 11 60723378 missense probably damaging 0.99
R0350:Flii UTSW 11 60721857 missense probably damaging 1.00
R0355:Flii UTSW 11 60719680 splice site probably null
R0524:Flii UTSW 11 60720061 missense probably damaging 0.98
R0636:Flii UTSW 11 60715552 missense probably damaging 1.00
R0639:Flii UTSW 11 60722997 splice site probably null
R1515:Flii UTSW 11 60721606 critical splice acceptor site probably null
R1544:Flii UTSW 11 60719692 critical splice donor site probably null
R1782:Flii UTSW 11 60714636 missense probably benign
R2922:Flii UTSW 11 60718916 missense probably damaging 1.00
R3691:Flii UTSW 11 60719757 missense probably benign 0.03
R3753:Flii UTSW 11 60715480 missense probably benign
R3875:Flii UTSW 11 60720492 missense probably benign
R3876:Flii UTSW 11 60719872 missense possibly damaging 0.85
R3924:Flii UTSW 11 60720076 missense probably damaging 1.00
R4621:Flii UTSW 11 60716111 missense possibly damaging 0.95
R4789:Flii UTSW 11 60715093 missense probably benign 0.33
R5153:Flii UTSW 11 60716686 missense possibly damaging 0.89
R5326:Flii UTSW 11 60718862 missense probably benign 0.30
R5340:Flii UTSW 11 60717268 missense probably damaging 0.99
R5364:Flii UTSW 11 60720128 missense probably benign 0.00
R5542:Flii UTSW 11 60718862 missense probably benign 0.30
R5592:Flii UTSW 11 60720399 missense probably benign 0.00
R5859:Flii UTSW 11 60716311 nonsense probably null
R5968:Flii UTSW 11 60720212 missense probably benign
R6287:Flii UTSW 11 60721597 missense probably damaging 1.00
R6368:Flii UTSW 11 60721136 missense probably damaging 1.00
R6997:Flii UTSW 11 60722325 missense probably benign 0.14
R7099:Flii UTSW 11 60720655 missense probably benign 0.05
R7324:Flii UTSW 11 60719040 missense probably benign
R7366:Flii UTSW 11 60721119 missense possibly damaging 0.67
R7371:Flii UTSW 11 60718264 missense probably benign 0.41
R7571:Flii UTSW 11 60721136 missense probably damaging 1.00
R7669:Flii UTSW 11 60722664 missense probably damaging 1.00
R7677:Flii UTSW 11 60720145 missense probably damaging 0.99
R7698:Flii UTSW 11 60720092 missense probably damaging 1.00
RF011:Flii UTSW 11 60716243 missense probably benign 0.04
X0025:Flii UTSW 11 60721708 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTGGCTACTGGACATACAGCC -3'
(R):5'- CCTTTGTGTCTGTCACTGAAGC -3'

Sequencing Primer
(F):5'- TACTGGACATACAGCCCGAGG -3'
(R):5'- TGTCACTGAAGCCCCACAGG -3'
Posted On2017-06-26