Mutagenetix > Incidental Mutation

Incidental Mutation 'R6009:Ints9'

479668

Institutional Source

Beutler Lab

Gene Symbol

Ints9

Ensembl Gene

ENSMUSG00000021975

Gene Name

integrator complex subunit 9

Synonyms

D14Ertd231e

MMRRC Submission

044186-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6009 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64950045-65039832 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65008082 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 263 (V263A)

Ref Sequence

ENSEMBL: ENSMUSP00000045552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043914]

AlphaFold

Q8K114

Predicted Effect

probably benign
Transcript: ENSMUST00000043914
AA Change: V263A

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: V263A

Domain	Start	End	E-Value	Type
Pfam:Lactamase_B_6	91	289	1.2e-17	PFAM
Beta-Casp	334	462	7.65e-16	SMART
low complexity region	583	596	N/A	INTRINSIC
low complexity region	672	682	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224593

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225790

Meta Mutation Damage Score

0.4374

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.3%
20x: 91.5%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr8	A	G	14: 29,978,497		probably benign	Het
Afap1	T	C	5: 35,997,560	S683P	probably damaging	Het
Chid1	T	A	7: 141,529,580	D131V	probably damaging	Het
Clstn2	C	T	9: 97,456,526	R860Q	probably benign	Het
Crlf1	A	C	8: 70,503,479	K403T	probably damaging	Het
Ctdspl2	T	G	2: 121,988,838	N201K	probably benign	Het
Cyb561a3	G	A	19: 10,586,808	V171I	possibly damaging	Het
Dazap1	T	C	10: 80,285,304		probably benign	Het
Dbf4	G	T	5: 8,403,718	Q235K	probably damaging	Het
Dgka	C	T	10: 128,723,679	G471D	probably damaging	Het
Fam13b	A	T	18: 34,497,405	F100Y	possibly damaging	Het
Flii	A	T	11: 60,720,757	L376*	probably null	Het
Fnip1	G	T	11: 54,502,271	G487V	probably damaging	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Golgb1	G	T	16: 36,914,959	A1523S	probably damaging	Het
Gstm4	A	G	3: 108,043,343	V114A	possibly damaging	Het
Gtf3c1	A	G	7: 125,647,430	F1569S	possibly damaging	Het
Gtf3c5	A	T	2: 28,571,165	D312E	probably benign	Het
Gtpbp1	G	A	15: 79,712,096	V149M	probably damaging	Het
Hoxa7	C	T	6: 52,217,387	V7M	probably damaging	Het
Il17f	C	T	1: 20,779,286		probably null	Het
Kansl1l	C	T	1: 66,735,600	C689Y	probably benign	Het
Kctd7	G	A	5: 130,145,198	G39E	probably damaging	Het
Krt82	T	A	15: 101,545,105	D282V	probably benign	Het
Lemd1	G	T	1: 132,228,252	E11*	probably null	Het
Maml2	A	G	9: 13,620,998	T503A	probably benign	Het
Mief2	A	G	11: 60,731,659	T352A	probably benign	Het
Msantd1	C	A	5: 34,917,705	T37K	probably benign	Het
Mtus2	A	G	5: 148,306,652	E94G	probably damaging	Het
Naaa	A	T	5: 92,259,581	L353Q	probably benign	Het
Nek5	T	C	8: 22,120,822	E55G	probably benign	Het
Npat	T	C	9: 53,563,449	M847T	probably damaging	Het
Nus1	G	A	10: 52,433,443	V268I	probably benign	Het
Olfr550	A	G	7: 102,578,594	N33S	possibly damaging	Het
Parn	C	T	16: 13,667,564	D23N	probably damaging	Het
Pdgfa	T	C	5: 138,979,199	E176G	probably damaging	Het
Plcl1	T	A	1: 55,696,246	F249I	probably damaging	Het
Plscr5	C	T	9: 92,204,435	Q153*	probably null	Het
Polr2b	T	C	5: 77,320,252	I133T	probably benign	Het
Polr3c	A	G	3: 96,713,614	S463P	probably damaging	Het
Pprc1	A	T	19: 46,071,732	I1530L	probably damaging	Het
Prex1	C	T	2: 166,581,984	S996N	probably damaging	Het
Rnf169	C	A	7: 99,927,123	R291S	possibly damaging	Het
Setd5	A	G	6: 113,110,519	K127R	probably damaging	Het
Slc25a26	G	T	6: 94,510,826	V89L	probably benign	Het
Slc4a10	A	G	2: 62,046,690	T16A	probably benign	Het
Smchd1	A	T	17: 71,440,956	H430Q	probably damaging	Het
Ttll7	A	T	3: 146,934,535	D503V	probably damaging	Het
Vav2	A	T	2: 27,271,900		probably null	Het
Zfp345	A	T	2: 150,472,517	C367S	probably damaging	Het
Zfp651	T	C	9: 121,762,871	S86P	possibly damaging	Het
Zfp964	T	A	8: 69,663,456	H235Q	possibly damaging	Het

Other mutations in Ints9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Ints9	APN	14	65037421	missense	probably benign	0.00
IGL02374:Ints9	APN	14	65039333	missense	probably benign	0.00
IGL02728:Ints9	APN	14	64993008	missense	probably damaging	1.00
IGL02992:Ints9	APN	14	64980164	missense	probably benign	0.08
IGL03151:Ints9	APN	14	65032340	missense	possibly damaging	0.86
R0437:Ints9	UTSW	14	64986369	splice site	probably benign
R0582:Ints9	UTSW	14	64980149	missense	probably damaging	1.00
R1525:Ints9	UTSW	14	64995011	missense	probably benign	0.05
R1569:Ints9	UTSW	14	64980122	missense	possibly damaging	0.91
R1835:Ints9	UTSW	14	65032256	missense	probably damaging	1.00
R1839:Ints9	UTSW	14	65016530	missense	probably damaging	1.00
R1862:Ints9	UTSW	14	65026413	missense	probably benign
R1892:Ints9	UTSW	14	65020423	missense	probably benign	0.08
R2146:Ints9	UTSW	14	64986343	missense	possibly damaging	0.71
R2285:Ints9	UTSW	14	65007997	missense	possibly damaging	0.61
R3015:Ints9	UTSW	14	64950278	missense	probably benign	0.00
R4133:Ints9	UTSW	14	64990554	missense	probably benign
R4180:Ints9	UTSW	14	64992981	missense	probably damaging	1.00
R4509:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4510:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4511:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4608:Ints9	UTSW	14	65032280	missense	possibly damaging	0.82
R5023:Ints9	UTSW	14	64980228	missense	probably damaging	1.00
R5117:Ints9	UTSW	14	64993091	nonsense	probably null
R5261:Ints9	UTSW	14	65008072	missense	probably benign	0.25
R5582:Ints9	UTSW	14	65028896	missense	possibly damaging	0.83
R5990:Ints9	UTSW	14	65039328	missense	probably damaging	1.00
R6241:Ints9	UTSW	14	64980210	missense	possibly damaging	0.90
R6351:Ints9	UTSW	14	64993007	missense	probably damaging	0.98
R6821:Ints9	UTSW	14	65037458	missense	probably benign	0.20
R7422:Ints9	UTSW	14	65032298	missense	possibly damaging	0.93
R7442:Ints9	UTSW	14	64995064	nonsense	probably null
R7475:Ints9	UTSW	14	65026465	missense	probably null	0.23
R8183:Ints9	UTSW	14	65036453	missense	probably damaging	0.98
R8223:Ints9	UTSW	14	65020360	missense	possibly damaging	0.94
R8282:Ints9	UTSW	14	65007308	missense	probably benign	0.00
R8314:Ints9	UTSW	14	65029030	missense	probably damaging	1.00
R8341:Ints9	UTSW	14	65036414	missense	probably benign	0.14
R8548:Ints9	UTSW	14	65032321	missense	probably benign	0.39
R9356:Ints9	UTSW	14	65032321	missense	probably benign	0.39
R9434:Ints9	UTSW	14	65008057	missense	probably benign	0.00
Z1176:Ints9	UTSW	14	65037454	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTGTTACAGCACAGCCACC -3'
(R):5'- GCACTCGCCTAGACTATCTAAGATC -3'

Sequencing Primer
(F):5'- ACAGCCACCATCATTCTGTCTG -3'
(R):5'- TCGCCTAGACTATCTAAGATCTAGAG -3'

Posted On

2017-06-26